South America Tuta absoluta juvenile hormone signal channel transcription factor Kr-h1 gene and application thereof
A technology of juvenile hormones and signaling pathways, applied in the field of agricultural biology, can solve the problems of reduced fecundity of surviving pupae and reduced survival rate of larvae
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Embodiment 1: Cloning of the full-length cDNA sequence of the tomato leaf miner Tuta absoluta Kr-h1 gene
[0019] Four larvae of the South American tomato leafminer were put into a 1.5mL centrifuge tube, frozen in liquid nitrogen, ground into powder with a grinding rod, and then RNA was extracted and stored at -80°C for later use. The extracted RNA was reverse-transcribed to synthesize cDNA according to the instructions of the All-in-One Gold Reverse Transcription Kit (TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR). Using cDNA as a template, primers were designed for PCR amplification. The designed primers are shown in Table 1:
[0020] Table 1 The sequence of primers for cloning the full-length cDNA of Btbrm1 gene
[0021] Primer name Primer sequence (5'-3') Kr-h1-F79 TCAACAAATTCCGCATTCG Kr-h1-R1347 TTTCAGGCAACATTCAACG
[0022] Utilize table 1 sequence, through PCR amplification, the cDNA sequence total length that...
Embodiment 2
[0023] Example 2: Analysis of the influence of Kr-h1 gene on the survival rate of South American tomato leaf miner larvae
[0024] 3.1 Synthesis of dsRNA
[0025] (1) Design and synthesize the primer sequence plus the T7 promoter (sequence shown underlined):
[0026] T7+dsKr-h1-F600:
[0027] 5'- TAATACGACTCACTATAGGGTGGTTGCGGTAAAGGATT -3'
[0028] T7+dsKr-h1-R1117:
[0029] 5'- TAATACGACTCACTATAGGGTAACAGGGTCTGGCTGAG -3'.
[0030] Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0031] (2) Extraction of total RNA and synthesis of cDNA: same as in Example 1.
[0032] (3) T7 primer PCR amplification and product purification, the purified PCR product is the template for synthesizing dsRNA. Use the kit to synthesize and purify dsRNA, and operate according to the kit instructions.
[0033] 3.2 dsRNA feeding
[0034] (1) petiole soaking method
[0035] Pick fresh leaves and dry the leaves for 1 hour, then soak the petioles in an aqueous soluti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


