Unlock instant, AI-driven research and patent intelligence for your innovation.

South America Tuta absoluta juvenile hormone signal channel transcription factor Kr-h1 gene and application thereof

A technology of juvenile hormones and signaling pathways, applied in the field of agricultural biology, can solve the problems of reduced fecundity of surviving pupae and reduced survival rate of larvae

Active Publication Date: 2021-07-23
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Kr-h1 silencing resulted in significantly reduced larval survival rate, pupal deformities, and reduced fecundity of surviving adults, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • South America Tuta absoluta juvenile hormone signal channel transcription factor Kr-h1 gene and application thereof
  • South America Tuta absoluta juvenile hormone signal channel transcription factor Kr-h1 gene and application thereof
  • South America Tuta absoluta juvenile hormone signal channel transcription factor Kr-h1 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1: Cloning of the full-length cDNA sequence of the tomato leaf miner Tuta absoluta Kr-h1 gene

[0019] Four larvae of the South American tomato leafminer were put into a 1.5mL centrifuge tube, frozen in liquid nitrogen, ground into powder with a grinding rod, and then RNA was extracted and stored at -80°C for later use. The extracted RNA was reverse-transcribed to synthesize cDNA according to the instructions of the All-in-One Gold Reverse Transcription Kit (TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR). Using cDNA as a template, primers were designed for PCR amplification. The designed primers are shown in Table 1:

[0020] Table 1 The sequence of primers for cloning the full-length cDNA of Btbrm1 gene

[0021] Primer name Primer sequence (5'-3') Kr-h1-F79 TCAACAAATTCCGCATTCG Kr-h1-R1347 TTTCAGGCAACATTCAACG

[0022] Utilize table 1 sequence, through PCR amplification, the cDNA sequence total length that...

Embodiment 2

[0023] Example 2: Analysis of the influence of Kr-h1 gene on the survival rate of South American tomato leaf miner larvae

[0024] 3.1 Synthesis of dsRNA

[0025] (1) Design and synthesize the primer sequence plus the T7 promoter (sequence shown underlined):

[0026] T7+dsKr-h1-F600:

[0027] 5'- TAATACGACTCACTATAGGGTGGTTGCGGTAAAGGATT -3'

[0028] T7+dsKr-h1-R1117:

[0029] 5'- TAATACGACTCACTATAGGGTAACAGGGTCTGGCTGAG -3'.

[0030] Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0031] (2) Extraction of total RNA and synthesis of cDNA: same as in Example 1.

[0032] (3) T7 primer PCR amplification and product purification, the purified PCR product is the template for synthesizing dsRNA. Use the kit to synthesize and purify dsRNA, and operate according to the kit instructions.

[0033] 3.2 dsRNA feeding

[0034] (1) petiole soaking method

[0035] Pick fresh leaves and dry the leaves for 1 hour, then soak the petioles in an aqueous soluti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of agricultural biology, and in particular relates to South America Tuta absoluta juvenile hormone signal channel transcription factor Kr-h1 gene and application thereof. The gene encodes protein with an amino acid sequence shown as SEQ ID NO:2. According to the invention, the juvenile hormone signal channel transcription factor Kr-h1 gene is obtained by cloning from a new important invasive pest, namely South America Tuta absoluta, for the first time; and larvae die after the invasive pest larvae eat the gene dsRNA. The obtained result provides a new way for preventing and treating new invasive pests by using RNAi.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to the transcription factor Kr-h1 gene of the South American tomato leafminer juvenile hormone signaling pathway and its application. Background technique [0002] The tomato leafminer Tuta absoluta is native to Peru in western South America. It can develop rapidly under suitable agro-ecological conditions, spread rapidly in new areas, and cause serious economic losses. It is a typical invasive species. This world quarantine pest invaded Spain in Europe in 2006. As of May 2017, it has occurred in 85 countries / regions in South America, Europe, Africa, Central America, Asia, etc., and is suspected in 22 countries / regions. Occurrence, causing devastating disasters to tomato and other crops, it can be seen that it has a very strong ability to spread rapidly and adapt. In August 2017, the tomato leaf miner was first discovered in Yili, Xinjiang, my country. In March of the foll...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/85C12N15/113A01N63/60A01P7/04
CPCC07K14/43563C12N15/85C12N15/113A01N63/60C12N2310/14Y02A90/40
Inventor 吕志创王晓迪冀顺霞刘万学张桂芬万方浩
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI