Chili capsaicin content close linkage SNP site, CAPS molecular marker and application thereof

A technology of molecular markers and capsaicin, which is applied in the field of pepper genetics and molecular biology, can solve problems such as genetic complexity, and achieve the effect of improving identification efficiency, identification efficiency and accuracy

Active Publication Date: 2021-07-23
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Due to the large number of genetic loci controlling capsaicin content and the genetic complexity, SNP loci and corresponding CAPS molecular markers that can efficiently and accurately identify high-capsaicin pepper strains have not yet been developed. Therefore, the existing technology needs further improvement. Improve

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chili capsaicin content close linkage SNP site, CAPS molecular marker and application thereof
  • Chili capsaicin content close linkage SNP site, CAPS molecular marker and application thereof
  • Chili capsaicin content close linkage SNP site, CAPS molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Exploitation and confirmation of closely linked SNP sites for capsaicin content in capsicum

[0037] 1. Acquisition of closely linked SNP sites for capsaicin content in capsicum

[0038] 311 annual capsicum (Capsicum annuum L.) were resequenced. The sequencing platform was IlluminaSolexa. Trimmomatic v0.33 was used to process the raw data to remove adapters, poly-N and low-quality fragments to obtain clean data. Clean data was obtained using BWA0.75 The data was compared to the Zunla-1 genome data (Qin et al., 2014), and the setting parameters were aln-o 1-e 10-t 4-l 32-i 15-q 10; using Samtools 0.1.19 (Li et al. , 2009), using the Bayesian algorithm, setting the parameter -q 1 -C50-S-D-m 2-F 0.002-u, running the command mpileup, searching for SNPs, filtering SNPs, setting the minimum gene allele frequency to be greater than 0.01, and the deletion rate to be less than 0.1.

[0039] 311 annual capsicum (Capsicum annuum L.) fruits were removed from the seeds an...

Embodiment 2

[0047] Example 2 Development of CAPS molecular markers closely linked to capsaicin content

[0048] 1. Design of CAPS primers

[0049] Design CAPS primers according to the SNP site provided in Example 1, the front primer is CA-capsF: AAAAGGGTTCTAATTCGCGGC (see SEQ ID NO: 2), the back primer is CA-capsR: GGAACTCTGGCTTGCAGGAT (see SEQ ID NO: 3), PCR amplification The product is 516bp, and its sequence is shown in SEQ ID NO: 1 in the sequence listing, and the S at the 227th position of the sequence is G / C, which is a polymorphic site.

[0050] 2. Extraction of sample genomic DNA and PCR amplification

[0051] The young leaves of 26 capsicum materials were selected for genomic DNA extraction for follow-up experiments, including 15 low-capsaicin materials (capsaicin content is less than 1200mg / kg, genotype CC), 11 high-capsaicin materials (capsaicin content The element content is higher than 1200mg / kg, and the genotype is GG). Two plants were taken from each material for paralle...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chili capsaicin content close linkage SNP site, a CAPS molecular marker and application thereof, the SNP site is the 22748122nd site on a chili No.6 chromosome, and the polymorphism of the SNP site is C / G. Aiming at the capsaicin content close linkage SNP site, the invention also provides a corresponding CAPS molecular marker, a specific primer pair and a method for identifying a capsicum variety with high capsaicin content by using the CAPS molecular marker, and the method is based on the characteristics of the SNP site and the application of a restriction enzyme cutting site, and combines gene amplification and restriction enzyme cutting methods to improve the identification efficiency of the chill variety with the high capsaicin content in further, the accuracy rate is high, and development of the CAPS marker has important significance on cultivation of the pepper variety with the high capsaicin content.

Description

technical field [0001] The invention relates to the fields of capsicum genetic breeding and molecular biology, in particular to a closely linked SNP site of capsicum capsaicin content, its CAPS molecular marker and application thereof. Background technique [0002] Pepper (Capsicum annuum L.), also known as ox horn pepper, long pepper, vegetable pepper, bell pepper; it is an annual or limited perennial herbaceous plant of the genus Capsicum in the family Solanaceae. Stems subglabrous or slightly pilose, branches slightly zigzag bent. Leaves alternate, entire or shallowly wavy. Flowers are solitary, twin or clustered on branches, drooping or erect; calyx cup-shaped, with 5-7 small teeth; corolla white, lobes ovate. The fruit stem is thick and drooping; the fruit is drooping or erect, and the fruit shapes are various, such as lantern-shaped, horn-shaped, linear, finger-shaped, etc. The green ripe fruit is mostly green or light green, and it is red, yellow, orange, etc. afte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/156C12Q2600/13C12Q2531/113C12Q2521/301C12Q2565/125
Inventor于海龙王立浩曹亚从程锋张亢张宝玺张正海冯锡刚靳远景雅欣
OwnerINST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI