Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rapid detection method of food-borne burkholderia gladioli

A technology of Holderella and detection methods, which is applied in the directions of microorganism-based methods, microorganism determination/inspection, biochemical equipment and methods, etc., to achieve the effects of easy popularization, good application prospects, and rapid detection.

Pending Publication Date: 2021-08-03
GUANGDONG TESTING INST OF PROD QUALITY SUPERVISION
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In summary, given that there is no real-time fluorescence detection method for Burkholderia gladiolus in food with good specificity and high sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid detection method of food-borne burkholderia gladioli
  • Rapid detection method of food-borne burkholderia gladioli
  • Rapid detection method of food-borne burkholderia gladioli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0034] A rapid detection method for food-borne Burkholderia gladiolus, characterized in that it comprises: performing a polymerase chain reaction in a polymerase reaction system, the reaction system containing amplified Gladiolus The specific primer pair of Kkholderia and Burkholderia gladiolus specific probe; The specific primer pair of described amplification Burkholderia gladiolus comprises: SEQ ID NO .1:16s-r:5'-GAATCCTACCGTGGTGACCGTCCTCCTTGCG-3'1460-1430;

[0035] SEQ ID NO.2:

[0036] 16S-F: 5'-AGCATGCCGCGGTGAATACGTTCCCGGGTCTT-3'1341-1372.

[0037] The Burkholderia gladiolus specific probe is a Taqman probe.

[0038] Further, the Burkholderia gladiolus specific probe has a nucleotide sequence selected from the following: SEQ ID NO.3:

[0039] 16S-P: ACACCGCCCGTCACACCATGGGAGTGGGTTTTTACCAC(FAMdT)(dSpa

[0040] cer)(BHQ1dT)GAAGTGGCTAGTC(phosphate) 1377-1425.

[0041] Further, a dSpacer is used at the position 37 bp away from the 5' end of the probe, and the two sides o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rapid detection method of food-borne burkholderia gladioli, which comprises the following steps: a polymerase chain reaction is carried out in a polymerase reaction system, wherein the reaction system contains a specific primer pair for amplifying burkholderia gladioli and a burkholderia gladioli specific probe; the specific primer pair for amplifying the burkholderia gladioli comprises primers as shown in SEQ ID NO.1 and SEQ ID NO.2, the burkholderia gladioli specific probe is a Taqman probe. The rapid detection method for the food-borne burkholderia gladioli established by the invention has the characteristics of strong specificity, high sensitivity, rapid detection and the like, can meet the requirements of daily rapid food detection, can avoid the investment of expensive instruments, is convenient to popularize and use in grassroots, and has a relatively good application prospect.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and nucleic acid detection. Specifically, the invention relates to a rapid detection method for Burkholderia gladiolus in food. Background technique [0002] Pseudomonas cocos subsp. Pseudomonas cocovenenans subsp. farinofermentans ), referred to as Pseudomonas cocos, is a new food poisoning bacterium discovered in Northeast my country in 1977 in fermented rice noodle poisoning food, and was classified as Burkholderia gladiolus in 2003 ( Burkholderia gladioli ) is a pathogenic type, the average death rate after poisoning can reach 41.8%. The oryzyme acid produced by this bacteria is the main toxic metabolite causing food poisoning and death. Food poisoning caused by Pseudomonas cocos subspecies fermented rice noodles has a wide range of epidemic areas and involves many types of food, mainly including fermented cereal products, spoiled white fungus and potato products. At present,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/06C12R1/01
CPCC12Q1/689C12Q1/6851
Inventor 张娟綦艳佘之蕴周臣清严家俊杨纯佳
Owner GUANGDONG TESTING INST OF PROD QUALITY SUPERVISION
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More