Myocardial ischemia re-perfusion injury marker circRNA and application thereof
A technology for reperfusion injury and myocardial ischemia, applied in the direction of DNA/RNA fragments, applications, cardiovascular system diseases, etc., can solve problems such as the complex mechanism of myocardial ischemia-reperfusion injury, and achieve the reduction of myocardial apoptosis level and infarct size. zoom out effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] The present invention adopts bioinformatics method, utilizes TargetScan and miRanda database to analyze and predict 10 circRNAs most likely to form a sponge adsorption relationship with miRNA-146a. The circRNA information is shown in Table 1.
[0033] Table 1 TargetScan and miRanda database predict circRNA
[0034]
[0035] Corresponding primers were designed according to the predicted results, and a mouse model of myocardial ischemia-reperfusion (reperfusion for 1 hour) and a sham operation model (sham) were established to verify the expression of these 10 circRNAs in myocardial tissue.
[0036] It was found that the expression level of mmu_circ_0001346 was significantly increased at 1 hour of ischemia-reperfusion (see figure 1 ), coincided with the time point when the expression of miRNA-146a decreased (results in figure 2 , the experimental method is qPCR; the upstream primer is: AGCTGAGGAGCGACAGAAAGTT (SEQ ID NO.8); the downstream primer is: CTCTGCCGTGTCCTTCTG...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap