Myocardial ischemia re-perfusion injury marker circRNA and application thereof

A technology for reperfusion injury and myocardial ischemia, applied in the direction of DNA/RNA fragments, applications, cardiovascular system diseases, etc., can solve problems such as the complex mechanism of myocardial ischemia-reperfusion injury, and achieve the reduction of myocardial apoptosis level and infarct size. zoom out effect

Active Publication Date: 2021-08-17
SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In general, the mechanism of myocardial ischemia-reperfusion injury is complex, and there are many intervention targets and measures. So far, there are few relatively simple and effective intervention measures applied to the prevention and treatment of clinical myocardial ischemia-reperfusion injury.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Myocardial ischemia re-perfusion injury marker circRNA and application thereof
  • Myocardial ischemia re-perfusion injury marker circRNA and application thereof
  • Myocardial ischemia re-perfusion injury marker circRNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The present invention adopts bioinformatics method, utilizes TargetScan and miRanda database to analyze and predict 10 circRNAs most likely to form a sponge adsorption relationship with miRNA-146a. The circRNA information is shown in Table 1.

[0033] Table 1 TargetScan and miRanda database predict circRNA

[0034]

[0035] Corresponding primers were designed according to the predicted results, and a mouse model of myocardial ischemia-reperfusion (reperfusion for 1 hour) and a sham operation model (sham) were established to verify the expression of these 10 circRNAs in myocardial tissue.

[0036] It was found that the expression level of mmu_circ_0001346 was significantly increased at 1 hour of ischemia-reperfusion (see figure 1 ), coincided with the time point when the expression of miRNA-146a decreased (results in figure 2 , the experimental method is qPCR; the upstream primer is: AGCTGAGGAGCGACAGAAAGTT (SEQ ID NO.8); the downstream primer is: CTCTGCCGTGTCCTTCTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a myocardial ischemia re-perfusion injury marker circRNA and application thereof, and belongs to the technical field of biology. The invention proves that circ-Fbxl5 can form a sponge adsorption relationship with miRNA-146a in myocardial cells so as to relieve the protective effect of the miRNA-146a on myocardial ischemia re-perfusion injury, and a shRNA (short hairpin ribonucleic acid) capable of knocking down circ-Fbxl5 expression is designed. Through detection, the prepared shRNA can knock down circ-Fbxl5 expression quantity, the infarct area of a myocardial ischemia re-perfusion mouse can be remarkably reduced, the myocardial apoptosis level is reduced, and it is proved that the prepared shRNA can be applied to the medicine for preventing and treating myocardial ischemia re-perfusion injury.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a myocardial ischemia-reperfusion injury marker circRNA and its application. Background technique [0002] Coronary heart disease is a major disease that seriously endangers human health and life. About 1.8 million patients worldwide die from this disease every year. Acute myocardial infarction (MI), as a serious type of coronary heart disease, is the leading cause of death and disability from coronary heart disease. Timely and effective opening of culprit vessels and restoration of myocardial blood perfusion are the main measures to save patients' lives and improve their quality of life, that is, myocardial ischemia-reperfusion (IR) therapy. However, as early as 1985, Braunwald pointed out that ischemia-reperfusion is actually a double-edged sword. Although the diseased blood vessels are opened and the dying myocardium is rescued, the free radicals and calcium overload and other f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/113C12N15/864A61K31/7088A61P9/10
CPCC12Q1/6883C12N15/113C12N15/86A61P9/10C12Q2600/158C12Q2600/178C12Q2600/136C12N2310/14C12N2750/14143C12N2800/107C12N2310/531
Inventor 王长谦李冬九毛承誉由佳音
Owner SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap