A myocardial ischemia-reperfusion injury marker circRNA and its application
A technology for reperfusion injury and myocardial ischemia, which is applied in the direction of DNA/RNA fragments, applications, cardiovascular system diseases, etc., can solve problems such as the complex mechanism of myocardial ischemia-reperfusion injury, and achieve the reduction of myocardial apoptosis and the reduction of infarct size. zoom out effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] The present invention adopts the method of bioinformatics and uses TargetScan and miRanda database analysis to predict 10 circRNAs that are most likely to form a sponge adsorption relationship with miRNA-146a. The circRNA information is shown in Table 1.
[0033] Table 1 CircRNAs predicted by TargetScan and miRanda database
[0034]
[0035] The corresponding primers were designed according to the predicted results, and a mouse myocardial ischemia-reperfusion (reperfusion 1 hour) model and a sham operation model (sham) were established to verify the expression of these 10 circRNAs in myocardial tissue respectively.
[0036] It was found that the expression level of mmu_circ_0001346 was significantly increased after 1 hour of ischemia-reperfusion (see figure 1 ), which is consistent with the time point of decreased miRNA-146a expression (results in figure 2 , the experimental method is qPCR; the upstream primer is: AGCTGAGGAGCGACAGAAAGTT (SEQ ID NO. 8); the downstr...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com