Nucleic acid composition for diagnosis or auxiliary diagnosis of liver cancer, detection kit and application thereof

A technology for auxiliary diagnosis and detection reagents, which is applied in the field of nucleic acid combination and detection kits for liver cancer diagnosis or auxiliary diagnosis, can solve the problems of lack of sensitivity and accuracy detection methods for hepatocellular carcinoma, and meet clinical needs, high sensitivity and specificity The effect of improving the detection rate

Active Publication Date: 2021-11-05
WUHAN AIMISEN LIFE TECH CO LTD
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is a lack of detection methods with high sensitivity and accuracy for HCC.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid composition for diagnosis or auxiliary diagnosis of liver cancer, detection kit and application thereof
  • Nucleic acid composition for diagnosis or auxiliary diagnosis of liver cancer, detection kit and application thereof
  • Nucleic acid composition for diagnosis or auxiliary diagnosis of liver cancer, detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of liver cancer, which includes a nucleotide combination 1, the nucleotide combination 1 includes the nucleotides shown in SEQ ID NO.1-3, the specific sequence list 1. The nucleotide combination 1 can detect the methylation of the Chr3:179450970-179451058 region positive strand (region 1) on the GNB4 gene;

[0047] The base sequence of positive strand in region 1 is as follows (5'-3'):

[0048] CACGCACGGGCTCGTGCTCTGAGTTCCTGGAAGGAGGCCTCGGGGAGTGACGAGAAACCAGGGGGGTCTGCAGGACTTGGACCGCCGAC.

Embodiment 2

[0050] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of liver cancer, which includes a nucleotide combination 2, the nucleotide combination 2 includes the nucleotides shown in SEQ ID NO.3-6, and the specific sequence is listed in Table 1 . The nucleotide combination 2 can detect the methylation of the positive strand (region 2) of the Chr3:179451090-179451203 region on the GNB4 gene;

[0051] The base sequence of positive strand in region 2 is as follows (5'-3'):

[0052] ACCGCCCGGGAAGTGCCTGCGCCGGCGGTCGTGGGGCCAGTTCCCGCGTGGCAGCTGGGCGCGACACAGGCGCGCCCTCCTCGTCCCTCCCGGGCAGCGTCGGCCGCCCGAGCC.

Embodiment 3

[0054] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of liver cancer, which includes nucleotide combination 3, which includes the nucleotides shown in SEQ ID NO.7-9, and the specific sequence is listed in Table 1. The nucleotide combination 3 can detect the methylation of the Chr3:179451231-179451356 region positive strand (region 3) on the GNB4 gene;

[0055] The positive strand base sequence of region 3 is as follows (5'-3'):

[0056] TCACCCGGGCCCCGTTCCGCAGGGGTGGCTCGCGGCGCCCCACGTCCCTGCGAGAAGCCCGGGATCGCTTCGCGGGGCGCACCGACGAGCCGCCGCTCGCGAGCTCGCCGCCTACCTGGAGGGAGC.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a nucleic acid composition for diagnosis or auxiliary diagnosis of liver cancer, a detection kit and application thereof, and relates to the technical field of gene detection. The methylation of the CpG island of the human GNB4 gene is taken as a marker, the liver cancer can be diagnosed or diagnosed in an auxiliary manner by detecting the increase of the methylation, and the sensitivity and the specificity are relatively high. By adopting the detection reagent and the kit provided by the invention, the detection rate of the liver cancer can be effectively improved, so that the clinical requirements of early screening and early diagnosis of the liver cancer are met.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a nucleic acid combination for liver cancer diagnosis or auxiliary diagnosis, a detection kit and applications thereof. Background technique [0002] Primary liver cancer is the fourth common malignant tumor and the second leading cause of cancer death in my country. Primary liver cancer mainly includes three different pathological types: hepatocellular carcinoma, intrahepatic cholangiocarcinoma, and mixed hepatocellular carcinoma-intrahepatic cholangiocarcinoma, among which hepatocellular carcinoma accounts for 85% to 90%. Hepatitis C virus (HBV / HCV) infection, non-alcoholic fatty liver disease caused by obesity, chronic alcohol abuse, etc., these factors may directly lead to the development of liver cirrhosis, and the annual incidence of liver cancer in patients with liver cirrhosis is about 2%-4 %. [0003] There are 855,000 new cases of primary liver cancer each year...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/154
Inventor 张良禄张玮董兰兰李国强昂学李婷婷
Owner WUHAN AIMISEN LIFE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products