Nucleic acid composition for diagnosis or auxiliary diagnosis of liver cancer, detection kit and application thereof
A technology for auxiliary diagnosis and detection reagents, which is applied in the field of nucleic acid combination and detection kits for liver cancer diagnosis or auxiliary diagnosis, can solve the problems of lack of sensitivity and accuracy detection methods for hepatocellular carcinoma, and meet clinical needs, high sensitivity and specificity The effect of improving the detection rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of liver cancer, which includes a nucleotide combination 1, the nucleotide combination 1 includes the nucleotides shown in SEQ ID NO.1-3, the specific sequence list 1. The nucleotide combination 1 can detect the methylation of the Chr3:179450970-179451058 region positive strand (region 1) on the GNB4 gene;
[0047] The base sequence of positive strand in region 1 is as follows (5'-3'):
[0048] CACGCACGGGCTCGTGCTCTGAGTTCCTGGAAGGAGGCCTCGGGGAGTGACGAGAAACCAGGGGGGTCTGCAGGACTTGGACCGCCGAC.
Embodiment 2
[0050] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of liver cancer, which includes a nucleotide combination 2, the nucleotide combination 2 includes the nucleotides shown in SEQ ID NO.3-6, and the specific sequence is listed in Table 1 . The nucleotide combination 2 can detect the methylation of the positive strand (region 2) of the Chr3:179451090-179451203 region on the GNB4 gene;
[0051] The base sequence of positive strand in region 2 is as follows (5'-3'):
[0052] ACCGCCCGGGAAGTGCCTGCGCCGGCGGTCGTGGGGCCAGTTCCCGCGTGGCAGCTGGGCGCGACACAGGCGCGCCCTCCTCGTCCCTCCCGGGCAGCGTCGGCCGCCCGAGCC.
Embodiment 3
[0054] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of liver cancer, which includes nucleotide combination 3, which includes the nucleotides shown in SEQ ID NO.7-9, and the specific sequence is listed in Table 1. The nucleotide combination 3 can detect the methylation of the Chr3:179451231-179451356 region positive strand (region 3) on the GNB4 gene;
[0055] The positive strand base sequence of region 3 is as follows (5'-3'):
[0056] TCACCCGGGCCCCGTTCCGCAGGGGTGGCTCGCGGCGCCCCACGTCCCTGCGAGAAGCCCGGGATCGCTTCGCGGGGCGCACCGACGAGCCGCCGCTCGCGAGCTCGCCGCCTACCTGGAGGGAGC.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com