Unlock instant, AI-driven research and patent intelligence for your innovation.

Multiplex PCR primer design method and device

A primer design and multiplexing technology, applied in the field of bioinformatics, can solve the problems of inability to check multiple PCR primer dimers and non-specific amplification, and achieve high amplification efficiency

Active Publication Date: 2022-07-29
SHANGHAI ORIGIMED CO LTD +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Generally, the amplicon size used in multiplex PCR design is about 300bp, but the fragment size of ctDNA is 90-150bp. In order to effectively detect MRD, the fragment size including the primer sequence during primer design can only be about 100bp or less.
Primer3 is the most widely used PCR primer design software. Usually, primer3 can only detect the hairpin structure and TM value between a pair of primers, and cannot check the primer dimer and non-specific amplification between multiple PCR primers. , while primer dimers and non-specific amplification are the key to the success of multiplex PCR and the detection of LOD (limit of detection)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex PCR primer design method and device
  • Multiplex PCR primer design method and device
  • Multiplex PCR primer design method and device

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0201] In this example, the mutation sites of 19 tumor patients were selected as monitoring sites, and 19 candidate primer pairs were designed as multiplex PCR primers for tumor patients. The primer information is shown in Table 1 below. Wherein, after optimization of the algorithm of the present invention, it is found that Primer5_R and Primer19_R form a complementary pairing of 6 bp at the 3' end, and Primer20 replaces Primer5 or Primer19 to form multiple PCR primers.

[0202] TGATCACAGTGTCTGGCCGAC

[0203] CGGCTGGATCGGGTATTTTTATG

[0204] In this example, 3 groups of experiments are designed to verify the performance of the algorithm. Among them, in group A, 19 pairs of primer sets composed of Primer1~19 are used as a group of multiplex PCR primers; in group B, Primer20 replaces Primer5 to form 19 pairs of primer sets as a group of multiplex PCR primers Primer: Group C, Primer20 replaces Primer19 to form 19 pairs of primer sets as a set of multiplex PCR primers, and the te...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a method and device for designing multiple PCR primers. The method includes: acquiring mutation information of a tumor sample, selecting a preset number of monitoring sites according to the mutation information to form a monitoring site set; Design at least one candidate primer pair with reference to the corresponding target sequence on the genome, and select one candidate primer pair for each monitoring site to generate an evaluation primer pair set corresponding to the monitoring site set; the evaluation primer pair set comes from different candidate primer pairs. Primer-dimer evaluation is performed for each pair of primers, and qualified candidate primer pairs are screened as target multiplex PCR primers according to the primer-dimer evaluation results of all primers in the evaluation primer pair set. The multiplex PCR primer design method of the present invention can design multiple PCR primers for the mutation sites of tumor patients, so as to achieve the purpose of stably detecting ctDNA mutation information with an abundance of ≥0.02%.

Description

technical field [0001] The invention relates to the technical field of bioinformatics, in particular, to a method and device for designing multiple PCR primers. Background technique [0002] Minimal Residual Disease (MRD) refers to the clinical state in which there are still a small number of tumor cells or small lesions in the patient during or after treatment, also known as Molecular Residual Disease or Measurable Residual Disease (Measurable Residual Disease). Residual Disease). [0003] MRD is applicable to both solid and hematologic tumors, and is more commonly used to represent the persistence of malignant cells below the standard detection limit in the bone marrow of patients with hematologic tumors. After tumor treatment, residual tumor cells in the body continue to proliferate, leading to disease recurrence. MRD may occur after treatment because not all cancer cells respond to treatment, or because tumor cells have developed resistance to the drugs used, and the p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G16H70/40G16B20/30G16B20/50
CPCG16H70/40G16B20/30G16B20/50
Inventor 王维锋郑新姚继成
Owner SHANGHAI ORIGIMED CO LTD