Multiplex PCR primer design method and device
A primer design and multiplexing technology, applied in the field of bioinformatics, can solve the problems of inability to check multiple PCR primer dimers and non-specific amplification, and achieve high amplification efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0201] In this example, the mutation sites of 19 tumor patients were selected as monitoring sites, and 19 candidate primer pairs were designed as multiplex PCR primers for tumor patients. The primer information is shown in Table 1 below. Wherein, after optimization of the algorithm of the present invention, it is found that Primer5_R and Primer19_R form a complementary pairing of 6 bp at the 3' end, and Primer20 replaces Primer5 or Primer19 to form multiple PCR primers.
[0202] TGATCACAGTGTCTGGCCGAC
[0203] CGGCTGGATCGGGTATTTTTATG
[0204] In this example, 3 groups of experiments are designed to verify the performance of the algorithm. Among them, in group A, 19 pairs of primer sets composed of Primer1~19 are used as a group of multiplex PCR primers; in group B, Primer20 replaces Primer5 to form 19 pairs of primer sets as a group of multiplex PCR primers Primer: Group C, Primer20 replaces Primer19 to form 19 pairs of primer sets as a set of multiplex PCR primers, and the te...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


