Methods and means for monitoring and modulating gene silencing
A gene, target gene technology, applied in the field of monitoring and regulating gene silencing and tools, can solve problems such as impossible measurement and difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0156] Example 1. ihpRNA constructs targeting two genes give stoichiometric silencing.
[0157] Construction of ihpRNA constructs targeting two genes.
[0158] A chimeric gene encoding an ihpRNA construct targeting two different genes was constructed, in sense reverse, comprising a 300nt floral locus C (FLC) gene (GenBank accession number AF116527, bases 620-920), followed by a 300nt check Acarone synthase (CHS) gene (GenBank accession number Y18603, bases 147-532), and the nucleotide sequence complementary to the mentioned 300 nt CHS followed by the nucleotide sequence complementary to the mentioned 300 nt FLC.
[0159] A 300 bp FLC fragment was amplified with oligonucleotide primers having the following sequences and the resulting product was cloned into pGEM T-easy (Promega, Madison, WI) to generate the CHS / FLC insert:
[0160] -5'CTCGAGTCTAGAGGAGCAGAAGCTGAGATGGAG 3' (SEQ ID NO 1) (Primer 138)
[0161] -5' CTGCAGGAATAAGGTACAAAGTTCATC 3' (SEQ ID NO 2) (Primer 136)
[0162...
Embodiment 2
[0198] Example 2. Modulation of CHS gene silencing with additional non-target sequence dilution in ihpRNA stems
[0199] In order to test the impact of extra nucleotides in the iphRNA or dsRNA molecule that is not related to the target DNA sequence on the degree of target gene silencing, many chimeric genes were generated, each in the antisense and sense orientations (referred to as CHS 反义 and CHS 有义 ) comprising 100 bp of nucleotide sequence from CHS (corresponding to GenBank accession number Y18603).
[0200] Gradually increasing nucleotide sequences unrelated to the CHS gene (from 100bp to 900bp; called extra-NNN-nt 有义 or extra-NNN-nt 反义 ) are inserted in antisense and sense orientations. The unrelated nucleotide sequence was from the FLC gene (corresponding to GenBank accession number NrAF116527).
[0201] Different CHS / additional nucleotide constructs were PCR amplified with attB1 and attB2 extension primers and introduced into pHELLSGATE 8 as described in Example 1. ...
Embodiment 3
[0210] Example 3. Northern blot analysis of transgenic plant lines containing chimeric genes encoding dsRNA regions targeting both FLC and CHS
[0211] RNA was prepared from different Arabidopsis plant lines containing two FLC-CHS hairpin constructs. One construct was a modified Hellsgate 12 vector (see WO 02 / 059294) with an FLC hairpin adjacent to the intron and a CHS fragment inserted at the attR site. Another construct was a modified Hellsgate 12 with a CHS hairpin adjacent to the intron and an FLC fragment inserted at the attR site. Two equivalent gels were electrophoresed and blotted and probed with FLC or CHS antisense RNA probes. RNase treated the blot to ensure that the signal was specific. figure 2 A shows the resulting autoradiography. Table 2 summarizes hybridization estimates for different probes and lines and in figure 2 Illustration in B. There appears to be a nice linear direct correlation between the amount of FLC and CHS signal in each line, suggesting ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More