Supercharge Your Innovation With Domain-Expert AI Agents!

KEX2 cleavage regions of recombinant fusion proteins

a fusion protein and kex2 technology, applied in the field of enhanced secretion and can solve the problems of high production protein levels with limited risk of contamination, relative quick scale up time, etc., and achieve enhanced secretion and/or cleavage of desired proteins, the effect of identifying enhanced secretion and/or cleavag

Inactive Publication Date: 2008-01-31
DANISCO US INC
View PDF13 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0012]In an additional embodiment, the invention relates to a method for identifying enhanced secretion and / or cleavage of a desired protein comprising a) altering a KEX2 site pre-sequence of a parental fusion polypeptide, said parental fusion polypeptide comprising a signal sequence; a KEX2 region comprising a KEX2 site and the KEX2 site pre-sequence which is located immediately N-terminal to said KEX2 site, and an amino acid sequence comprising a desired protein to produce a set of test fusion polypeptides that are identical to said parental fusion polypeptide except for said KEX2 site pre-sequence; b) evaluating secretion of said test fusion polypeptides and said parental fusion polypeptide by a filamentous fungal cell; c) identifying a test fusion polypeptide that has enhanced secretion and / or cleavage as compared to said parental fusion polypeptide.

Problems solved by technology

While numerous methods are available for the production of industrial enzymes and therapeutic proteins, there remains a need for alternative methods of protein production and particularly for therapeutic protein production, such as antibody production, which will result in relatively quick scale up time and high levels of produced protein with limited risk of contamination by viral or other adventitious agents.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • KEX2 cleavage regions of recombinant fusion proteins
  • KEX2 cleavage regions of recombinant fusion proteins
  • KEX2 cleavage regions of recombinant fusion proteins

Examples

Experimental program
Comparison scheme
Effect test

example 1

Construction of a Trastuzumab (Light Chain Expression Strain Containing a KRGGG (SEQ ID NO: 2) KEX2 Cleavage Site

[0169]DNA (SEQ ID NO:1) encoding the light chain of trastuzumab according to the published amino acid sequence of antibody 4D5-8 (Carter et al, Proc. Natl. Acad. Sci. 1992 89: 4285-4289) was synthesized by DNA2.0 Inc. (1455 Adams Drive, Menlo Park, Calif. 94025).

(SEQ ID NO: 1)ACTAGTAAACGCGGTGGCGGTGATATTCAAATGACACAATCTCCTTCTTCTCTGTCAGCCTCAGTGGGCGACCGTGTGACGATTACTTGCCGCGCCTCTCAGGACGTTAACACTGCCGTCGCATGGTACCAGCAGAAGCCAGGCAAGGCGCCCAAGCTTCTGATTTACAGCGCTTCGTTCCTGTACTCTGGCGTGCCATCCCGCTTCTCTGGCAGCCGAAGCGGCACGGATTTCACCCTGACCATTTCGTCCCTGCAGCCCGAGGATTTCGCCACGTATTACTGCCAGCAGCACTACACCACTCCACCCACCTTTGGCCAAGGAACGAGAGTCGAAATCACTCGCACGGTCGCTGCCCCTTCAGTCTTCATCTTCCCCCCCAGCGACGAACAGCTGAAGTCTGGTACGGCCAGCGTCGTTTGCTTGCTTAATAACTTCTATCCGCGAGAGGCGAAGGTCCAATGGAAGGTTGATAACGTTCTGCAGTCCGGCAATTCGCAGGAGAGCGTGACCGAGCAGGATTCAAAGGATAGCACCTACTCACTCAGCAGCACCCTGACGTTGTCCAAGGCCGATTACGAGAAGCATAAGTTGTATGCATGCGAGG...

example 2

Construction of a Trastuzumab Light Chain Expression Strain Containing the GGGKR (SEQ ID NO: 5) KEX2 Cleavage Site

[0171]Two primers (GGACTAGTGGTGGCGGTAAACGCGATATTCAAATGACACAATCT C; SEQ ID NO:3 and AAGGCGCGCCTTAGCACTCGCCTCGATTG; SEQ ID NO:4) were synthesized by Invitrogen (1600 Faraday Avenue. Carlsbad, Calif. 92008) and used to amplify trastuzumab light chain DNA.

[0172]The resulting PCR fragment encodes the antibody light chain containing a GGGKR (SEQ ID NO:5) sequence kex2 site at its N-terminal end. The PCR fragment was digested with restriction enzymes SpeI and AscI and cloned to expression Vector pTrex4 to generate a plasmid named as pTrex4-GGGKR-her2 DNA2.0. Fidelity of the PCR fragment was analyzed by DNA sequencing. The plasmid was digested with XbaI restriction enzyme and transformed biolistically using standard techniques into the T. reesei strain described above. More than 20 transformants were obtained and transferred to new plates. A total of 21 stable transformants were...

example 3

Construction of a Trastuzumab Light Chain Expression Strain Containing a GGGKRGGG (SEQ ID NO: 7) KEX2 Cleavage Site

[0173]Two oligos, GGACTAGTGGCGGTGGCAAACGCGGTGGCGGTGATATTC (SEQ ID NO. 6) and AAGGCGCGCCTTAGCACTCGCCTCGATTG (SEQ ID NO. 4), were synthesized by Invitrogen and used to amplify light chain DNA. The resulting PCR fragment encodes light chain and GGGKRGGG (SEQ ID NO:7) sequence for kex2 cleavage. The PCR fragment was digested with restriction enzymes SpeI and AscI and cloned to expression Vector pTrex4 to generate a plasmid named as pTrex4-GGGKRGGG-her2 light chain DNA2.0. Fidelity of the PCR fragment was analyzed by DNA sequencing. The plasmid was digested with XbaI restriction enzyme and transformed biolistically into the T. reesei strain as described above. More than 10 transformants were obtained and transferred to new plates. 3 stable transformants were selected to grow in Proflo media for 2 days at 30° C. 5 mls of 2 days old culture from Proflo were transferred to 50 m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
nucleic acidaaaaaaaaaa
catalytic activityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a fusion DNA construct comprising a KEX2 region comprising a KEX2 site and a KEX2 site pre-sequence immediately 5′ to the KEX2 site, a fusion polypeptide, vectors and cells comprising the fusion DNA construct, methods for producing desired proteins from filamentous fungal cells and methods for enhancing the secretion and / or cleavage of a desired protein from a cell.

Description

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT[0001]Portions of this work were funded by Contract No. W911NF-05-C-0072 by the Defense Advanced Research Projects Agency (DARPA) of the U.S. Accordingly, the United States Government may have certain rights in this invention.FIELD OF THE INVENTION[0002]The present invention relates to increased secretion and cleavage of desired proteins, such as functional antibody proteins and industrial enzymes from filamentous fungi. The invention discloses fusion DNA constructs, vectors and fusion polypeptides incorporating KEX2 regions for protein cleavage and methods of producing desired proteins.BACKGROUND[0003]During protein secretion in a fungal cell, certain proteins are cleaved by KEX2, a member of the KEX2 or “kexin” family of serine peptidase (EC 3.4.21.61). KEX2 is a highly specific calcium-dependent endopeptidase that cleaves the peptide bond that is immediately C-terminal to a pair of basic a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12Q1/68C07H21/04C12N15/74C07K14/37C12N1/16
CPCC07K16/32C07K16/46C07K16/462C12N15/62C12N15/80C07K2319/00
Inventor WANG, HUAMINGWARD, MICHAEL
Owner DANISCO US INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com