Supercharge Your Innovation With Domain-Expert AI Agents!

Modulation of phosphoenolpyruvate carboxykinase-mitchondrial (pepck-m) expression

a technology of phosphoenolpyruvate and kinasemite, which is applied in the direction of enzymology, lyase, carbon-carbon lyase, etc., can solve the problems of lack of acceptable options for treating metabolic disorders, none of the previously described disclosures describe a specific mechanism of antisense, and unsatisfactory side effects

Inactive Publication Date: 2013-08-22
IONIS PHARMA INC
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent describes a method for reducing certain substances in an animal, such as insulin, resistance, triglycerides, and body fat. This is achieved by giving the animal a specific type of modified oligonucleotide that targets a certain gene. The method can be effective in treating metabolic disease in animals, reducing its symptoms.

Problems solved by technology

However, none of the inhibitors enumerated above are specific for PEPCK-M and may therefore produce undesirable side-effects.
Furthermore, none of the previously described disclosures describe a specific mechanism of antisense inhibition of PEPCK-M for the treatment of metabolic diseases.
There is a currently a lack of acceptable options for treating metabolic disorders.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modulation of phosphoenolpyruvate carboxykinase-mitchondrial (pepck-m) expression
  • Modulation of phosphoenolpyruvate carboxykinase-mitchondrial (pepck-m) expression
  • Modulation of phosphoenolpyruvate carboxykinase-mitchondrial (pepck-m) expression

Examples

Experimental program
Comparison scheme
Effect test

example 1

Antisense Inhibition of Human Phosphoenolpyruvate Carboxykinase-Mitochondrial (PEPCK-M) in T-24 Cells

[0383]Antisense oligonucleotides targeted to a human PEPCK-M nucleic acid were tested for their effect on PEPCK-M RNA transcript in vitro. Cultured T-24 cells at a density of 20,000 cells per well were transfected using electroporation with 150 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and PEPCK-M RNA transcript levels were measured by quantitative real-time PCR with human primer probe set RTS133 (forward sequence AGACCCTGCGAGTGCTTAGTG, designated herein as SEQ ID NO: 6; reverse sequence GATGTGGATGCCCTCTGGTT, designated herein as SEQ ID NO: 7; probe sequence CCAGCTTCCCACTGGCATTCGAGATTX, designated herein as SEQ ID NO: 8). PEPCK-M RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of PEPCK-M, relative to untreated control cells.

[0384]The antisense o...

example 2

Antisense Inhibition of Rat PEPCK-M in Primary Rat Hepatocytes

[0385]Antisense oligonucleotides targeted to a rat PEPCK-M nucleic acid were tested for their effect on PEPCK-M RNA transcript in vitro. Primary rat hepatocytes were cultured at a density of 20,000 cells per well were transfected using Cytofectin reagent with 100 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and PEPCK-M RNA transcript levels were measured by quantitative real-time PCR with rat primer probe set RTS3036 (forward sequence TGGGAAAGCCATGGAAACC, designated herein as SEQ ID NO: 49; reverse sequence GCGAGCCGGGACACAA, designated herein as SEQ ID NO: 50; probe sequence ACAAGGAACCCTGTGCGCATCCAAX, designated herein as SEQ ID NO: 51). PEPCK-M RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of PEPCK-M, relative to untreated control cells.

[0386]The antisense oligonucleotides in Tables ...

example 3

Dose-Dependent Antisense Inhibition of Rat PEPCK-M in Rat Primary Hepatocytes

[0388]Antisense oligonucleotides exhibiting inhibition of PEPCK-M in rat primary hepatocytes (see Example 2) were tested at various doses. Cells were plated at a density of 20,000 cells per well and transfected using Cytofectin® reagent with 12.5 nM, 25 nM, 50 nM, 100 nM, and 200 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and PEPCK-M transcript levels were measured by quantitative real-time PCR using primer probe set RTS3036. PEPCK-M transcript levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Table 7 as percent inhibition of PEPCK-M, relative to untreated control cells.

TABLE 7Dose-dependent antisense inhibition of rat PEPCK-M in rat primary hepatocytesISIS12.525.050.0100.0200.0IC50No.nMnMnMnMnM(nM)42101502353769285.4421017132142678971.642102581539688579.442103401536628270.24210361423396987...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
waist circumferenceaaaaaaaaaa
waist circumferenceaaaaaaaaaa
lengthaaaaaaaaaa
Login to View More

Abstract

Provided herein are methods, compounds, and compositions for reducing expression of phosphoenolpyruvate carboxykinase-mitochondrial (PEPCK-M) mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for preventing or decreasing diabetes, obesity, metabolic syndrome, diabetic dyslipidemia, and / or hypertriglyceridemia in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of diabetes, obesity, metabolic syndrome, diabetic dyslipidemia, and / or hypertriglyceridemia, or a symptom thereof.

Description

[0001]This application claims the benefit of priority of provisional application Ser. No. 61 / 353,601, filed Jun. 10, 2010, the entire contents of which is incorporated herein by reference.STATEMENT OF GOVERNMENT SUPPORT[0002]This invention was made with United States Government support under NIH Grants K08 DK-080142 and R01 DK-40936. The United States Government has certain rights in the invention.SEQUENCE LISTING[0003]The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0132WOSEQ.TXT, created on Jun. 10, 2010 which is 101 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.FIELD OF THE INVENTION[0004]Provided herein are methods, compounds, and compositions for reducing expression of phosphoenolpyruvate carboxykinase-mitochondrial (PEPCK-M) mRNA and protein in an animal. Also, provided herein are methods, compounds...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K31/7088
CPCC12N2310/14C12N2310/346C12Y401/01032C12N15/1137C12N2310/11A61K31/7088C12N2310/315C12N2310/3341C12N2310/341C12N2310/321C12N2310/3525
Inventor BHANOT, SANJAYSHULMAN, GERALD
Owner IONIS PHARMA INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More