Unlock instant, AI-driven research and patent intelligence for your innovation.

Full-length infectious CDNA clones of tick borne flavivirus

A flavivirus, infectious technology, applied in the field of full-length infectious cDNA cloning of tick-borne flaviviruses, and can solve problems such as toxicity

Inactive Publication Date: 2008-08-20
US DEPT OF HEALTH & HUMAN SERVICES
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

I. Virus Toxicity to Mice and Monkeys

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Full-length infectious CDNA clones of tick borne flavivirus
  • Full-length infectious CDNA clones of tick borne flavivirus
  • Full-length infectious CDNA clones of tick borne flavivirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0098] Method 1: Subcloned fragments of the TP21 genome from high-titer viral preparations

[0099] This method uses 4 overlapping cDNA fragments previously cloned in Escherichia coli (Fig. 1, part A) to determine the complete nucleotide sequence of the LGT TP21 genome (Pletnev, A.G., and Men, R. (1998). By cooperating with Chimeric attenuated Langat tick-borne flaviviruses of mosquito-borne dengue flavivirus type 4. Proc. Natl. Acad. Sci. USA 95, 1746-1751.). These plasmid clones, p5 (LGT nucleotides 1 to 983), p44 (nucleotides 930 to 4828), p66 (nucleotides 4539 to 6571) and p76 (nucleotides 6525 to 10,943), were obtained from 1.8× 10 9 LGT cDNA library prepared from high-titer virus suspension of PFU / ml. DNA fragment p5 was amplified by PCR using the forward primer (oligo 1444) 5'-GAAGGTGGTCTTTGCGGCCGCATCATACACATACGATTTAGGTGACACTATAGAGATTTTCTTGCGCGTGCATGC (SEQ ID NO1) including the NotI site and the SP6 promoter immediately upstream of the 5' end of the genome 1-22 nucl...

Embodiment 2

[0103] Method 2: Long RT-PCR cDNA of viral genome

[0104] This method applies long RT-PCR to a single attempt to generate cDNAs of viral genome length. Two different viral suspensions were used as sources of viral cDNAs; one suspension harvested the next day had a lower titer (3.8 × 10 3 PFU / ml), while another suspension obtained on the fifth day had a higher titer (2.4×10 9 PFU / ml). The PCR mix contained primers (oligo 1444 and 1445), 101RT product as template and Takara LA PCR (PanVera Co., Madison, WI) kit components including 5U DNA polymerase. The PCR product, approximately 11 kb long, was separated from low molecular weight DNA by electrophoresis in an agarose gel and isolated from the gel using a Qiagen gel extraction kit (Venlo, The Netherlands). Before being used as templates for RNA transcription, PCR products were digested with EcoRV and purified by benzene-chloroform extraction. RNA transcripts (approximately 1 g) of these cDNAs were then transfected into Ve...

Embodiment 3

[0106] Method 3: Construction of full-length cDNA clones from two overlapping PCR fragments from low-titer viruses

[0107] The method uses two overlapping cDNA fragments that include the complete sequence of TP21 (Fig. 1, part C). These fragments come from a low concentration of virus suspension (3.8×10 3 PFU / ml). For the 5' half of the LGT genome, a forward primer (oligo 1444) comprising NotI site, SP6 promoter and LGT sequence 1-22 nucleotides and a reverse primer complementary to LGT nucleotides 6637-6657 ( oligo 1023) 5'-CCCAGGGTTGCAAGCCCCAGG (SEQ ID NO 5), resulting in a PCR product. PCR was used to generate the 3' half of the LGT genome, using a forward primer (oligo 971) 5'-TTGCACCTGACTGAACTGGAG (SEQ ID NO 6) complementary to LGT nucleotides 4451-4471, and oligo 1445 as a reverse primer.

[0108]Initially, a representative chimeric virus was constructed by substituting the structural protein gene by using the p2A(XhoI) vector (Bray, M., and Lai, C.-J. (1991). Proc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A full-length infectious cDNA clone of Langat tick-borne flavivirus.

Description

Background of the invention [0001] There are more than 60 antigenically related, positive-sense RNA viruses in the Arthropod-borne Flavivirus genus of the Flaviviridae family, many of which are important human pathogens. Antigenically related tick-borne encephalitis virus complexes of the flavivirus family include tick-borne encephalitis virus (TBEV, formerly known as Russian spring-summer encephalitis virus), Kosanur forest disease, Langat, jumping disease, Negishi, Omsk hemorrhagic fever and Powassan virus (Calisher, C.H., Karabatsos, N., Dalrymple, J.M., Shope, R.E., Porterfield, J., Westaway, E.G., and Brant, W.E. (1989) by cross-linking with polyclonal antisera Neutralization assay to determine antigenic interrelationships between flaviviruses. J.Gen.Virol., 70, 27-43.; Monath, T.P., and Heinz, F.X. (1996) Flaviviruses. See "Fields Virology" (B.N. Fields, D.M. Knipe & P.M. Howley, eds.), Third Edition, pp. 961-1035. Lippincott-Raven Publishers, Philadelphia and New York)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/18C12N7/04A61K39/12A61P31/14A61K39/193C07H21/04C12N5/00C12N5/02C12N7/00C12N7/01C12N7/08C12N15/00C12N15/09C12N15/63C12N15/70C12N15/74
CPCC12N2770/24122A61K39/12A61K2039/5254C12N2770/24164C12N7/00C12N2770/24161C07K14/005C12N2770/24134A61P31/14
Inventor A·普列特尼奥夫R·沙诺克
Owner US DEPT OF HEALTH & HUMAN SERVICES