Full-length infectious CDNA clones of tick borne flavivirus
A flavivirus, infectious technology, applied in the field of full-length infectious cDNA cloning of tick-borne flaviviruses, and can solve problems such as toxicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Method used
Image
Examples
Embodiment 1
[0098] Method 1: Subcloned fragments of the TP21 genome from high-titer viral preparations
[0099] This method uses 4 overlapping cDNA fragments previously cloned in Escherichia coli (Fig. 1, part A) to determine the complete nucleotide sequence of the LGT TP21 genome (Pletnev, A.G., and Men, R. (1998). By cooperating with Chimeric attenuated Langat tick-borne flaviviruses of mosquito-borne dengue flavivirus type 4. Proc. Natl. Acad. Sci. USA 95, 1746-1751.). These plasmid clones, p5 (LGT nucleotides 1 to 983), p44 (nucleotides 930 to 4828), p66 (nucleotides 4539 to 6571) and p76 (nucleotides 6525 to 10,943), were obtained from 1.8× 10 9 LGT cDNA library prepared from high-titer virus suspension of PFU / ml. DNA fragment p5 was amplified by PCR using the forward primer (oligo 1444) 5'-GAAGGTGGTCTTTGCGGCCGCATCATACACATACGATTTAGGTGACACTATAGAGATTTTCTTGCGCGTGCATGC (SEQ ID NO1) including the NotI site and the SP6 promoter immediately upstream of the 5' end of the genome 1-22 nucl...
Embodiment 2
[0103] Method 2: Long RT-PCR cDNA of viral genome
[0104] This method applies long RT-PCR to a single attempt to generate cDNAs of viral genome length. Two different viral suspensions were used as sources of viral cDNAs; one suspension harvested the next day had a lower titer (3.8 × 10 3 PFU / ml), while another suspension obtained on the fifth day had a higher titer (2.4×10 9 PFU / ml). The PCR mix contained primers (oligo 1444 and 1445), 101RT product as template and Takara LA PCR (PanVera Co., Madison, WI) kit components including 5U DNA polymerase. The PCR product, approximately 11 kb long, was separated from low molecular weight DNA by electrophoresis in an agarose gel and isolated from the gel using a Qiagen gel extraction kit (Venlo, The Netherlands). Before being used as templates for RNA transcription, PCR products were digested with EcoRV and purified by benzene-chloroform extraction. RNA transcripts (approximately 1 g) of these cDNAs were then transfected into Ve...
Embodiment 3
[0106] Method 3: Construction of full-length cDNA clones from two overlapping PCR fragments from low-titer viruses
[0107] The method uses two overlapping cDNA fragments that include the complete sequence of TP21 (Fig. 1, part C). These fragments come from a low concentration of virus suspension (3.8×10 3 PFU / ml). For the 5' half of the LGT genome, a forward primer (oligo 1444) comprising NotI site, SP6 promoter and LGT sequence 1-22 nucleotides and a reverse primer complementary to LGT nucleotides 6637-6657 ( oligo 1023) 5'-CCCAGGGTTGCAAGCCCCAGG (SEQ ID NO 5), resulting in a PCR product. PCR was used to generate the 3' half of the LGT genome, using a forward primer (oligo 971) 5'-TTGCACCTGACTGAACTGGAG (SEQ ID NO 6) complementary to LGT nucleotides 4451-4471, and oligo 1445 as a reverse primer.
[0108]Initially, a representative chimeric virus was constructed by substituting the structural protein gene by using the p2A(XhoI) vector (Bray, M., and Lai, C.-J. (1991). Proc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 