Check patentability & draft patents in minutes with Patsnap Eureka AI!

Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application

A technology of wheat sheath blight and molecular markers, applied in the fields of wheat breeding and molecular biology, to reduce workload, improve accuracy and breeding efficiency

Inactive Publication Date: 2009-07-29
JIANGSU ACAD OF AGRI SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Wheat variety CI12633 is a material resistant to powdery mildew from the United States. It has been identified as a material resistant to sheath blight by sheath blight (Liu Zhaohui, 2000; Yan Wei, 2004), and has been used in wheat breeding for sheath blight resistance (Cai Shibin , 2005), there is no molecular marker linked to the major QTL for sheath blight resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application
  • Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application
  • Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Determination of Resistance Source CI12633 to Wheat Sheath Blight

[0018] 1. Obtain the DNA of wheat variety CI12633

[0019] The leaves of the plants of the wheat variety CI12633 were separated and extracted by using the CTAB extraction method to extract the DNA.

[0020] 2. Detect the DNA of wheat variety CI12633, and screen out the molecular markers closely linked to the wheat sheath blight resistance QTL

[0021] The obtained DNA was amplified using PCR right border primers and left border primers 5'CGCTGAAAAGAAGTGCCGCATTATGA 3' and 5'CGCTGCCTTTTCTGGATTGCTTGTCA3, and the amplified product was separated by electrophoresis on a 6% polyacrylamide gel to obtain a molecular marker with a size of 180bp gwm608.

[0022] The obtained DNA was amplified by using the primers 5'CACTACAACTATGCGCTCGC3' and 5'TCCATTGGCTTCTCTCTCAA3' of the PCR right boundary primer and the left boundary primer, and the amplified product was separated by electrophoresis on a 6% polyacrylamide gel...

Embodiment 2

[0029] The molecular markers gwm608, gwm88, wmc727 and gwm410.2 with sizes of 180bp, 130bp, 200bp and 300bp were used to predict the resistance of wheat variety CI12633 to sheath blight resistance.

[0030] The wheat variety CI12633 was crossed with Yangmai 158 and propagated to F 8 The progeny of offspring, DNA was first isolated from their leaves, and then polymerase chain reaction (PCR) was carried out on these DNAs with primers of molecular markers gwm608, gwm88, wmc727 and gwm410.2 [isolation and extraction of DNA and PCR amplification and electrophoresis The isolation process is the same as in Example 1], judge whether there are at least three of the above-mentioned markers in the isolates after the PCR of these DNAs, if there are more than three of the above-mentioned markers at the same time, it means that the resistance of the strain to sheath blight has reached "moderate resistance" Above level, can not exist at the same time more than three above-mentioned marks and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to molecular markers closely linked with Thanatephorus cucumeris resistance QTL, and their applications. The volumes of molecular markers gwm608, gwm88, wmc727 and gwm410.2 are 180bp, 130bp, 200bp and 300bp, respectively. The molecular markers can be used for detecting the genotypes of wheat variety CI12633 and its derived varieties or lines, and identifying Thanatephorus cucumeris resistant wheat varieties or lines. The molecular markers overcome the problems of long detection period and low efficiency faced by normal methods, and are rapid and highly efficient. Besides, the molecular markers also have such advantages as convenient resistance detection, no environmental influence, high accuracy and high efficiency.

Description

technical field [0001] The invention relates to the fields of wheat breeding and molecular biology. The molecular marker closely linked with wheat sheath blight resistance QTL is used for assisted breeding to improve the efficiency of wheat sheath blight resistance breeding. Background technique [0002] Wheat sheath blight, also known as wheat sharp eyespot (Wheat sharp eyespot), is a worldwide disease, almost all over the temperate wheat growing areas in the world. In recent years, with the continuous improvement of fertilization level and the change of farming system, sheath blight has widely occurred in the winter wheat areas of the Yangtze River and Huaihe River Basin and the middle and lower reaches of the Yellow River. The area of ​​wheat fields affected by sheath blight every year accounts for about one fifth of the planted area , The economic loss is more than several billion yuan. Studies have shown that wheat sheath blight is a kind of stubborn soil-inhabiting fu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11A01H1/00
Inventor 任丽娟周淼平余桂红张旭陆维忠马鸿翔
Owner JIANGSU ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More