Strict hypoxia targeting carrier and uses thereof

A technology of hypoxia response element and expression vector, applied in the fields of genetic engineering and pharmacy, which can solve problems such as loss of transcriptional response

Inactive Publication Date: 2008-02-06
INST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

HIF1-binding site mutations lead to loss of gene transcriptional responses to hypoxia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strict hypoxia targeting carrier and uses thereof
  • Strict hypoxia targeting carrier and uses thereof
  • Strict hypoxia targeting carrier and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Construction of pVAX-HRE vector

[0021] Entrust a biological company to synthesize the HRE gene, its DNA sequence is as follows, with Sma I and Bgl II restriction sites at both ends:

[0022] CCCGGGCTGCAGGAATTCGATGCACGCGTCCGGGTAGCTGGCGTACGTGCTGCAACCGGGTAGCTGGCGTACGTGCTGCAGCCGGGTAGCTGGCGTACGTGCTGCAGCTCGAGACTTGACGCGTCCGGGTACCTGGCGTACGTGCTGCAGCCGGGTAGCTGGCGTACGTGCTGCAGCCGGGTATCTGGCGTACGTGCTGCAGCTCGAGACTTGACGCGTCCGGGTAGCTGGCGTACGTGCTGCAGCCGGGTAGCTGGCGTACGTGCTGCAGCCGGGTAGCTGGCGTACGTGCTGCAGCTCGAGATCT(SEQ ID NO:4)。

[0023] The fragments of vector pVAX and HRE were respectively taken, double-digested with Sma I and Bgl II, subjected to 1% and 2% gel electrophoresis respectively, and each fragment was recovered with a gel recovery kit. The pVAX vector fragment and the HRE fragment were mixed at a ratio of 1:3, added with T4 ligase, and reacted at 16°C for 16 hours, and the reaction product was transformed into competent E. Figure 1, Figure 2). Positive clones were ...

Embodiment 2

[0024] Example 2. Construction of pVAX-HRE-ODD vector

[0025] Entrust a biological company to synthesize the ODD gene, its DNA sequence is as follows, with HindIII and BamH I restriction sites at both ends:

[0026] AAGCTTATGAACCCATTTTCTACTCAGGACACAGATTTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACAGTATTCCAGGATCC (SEQ ID NO: 5).

[0027] The fragments of vector pVAX-HRE and ODD were respectively taken, and double-digested with Hind III and BamH I, and subjected to 1% and 2% gel electrophoresis respectively, and each fragment was recovered with a gel recovery kit. Mix the pVAX-HRE vector fragment and the ODD fragment at a ratio of 1:3, add T4 ligase, react at 16°C for 16 hours, transform the reaction product into competent E. Identification (Figure 3). Positive clones were named pVAX-HRE-ODD.

Embodiment 3

[0028] Example 3. Construction of pVAX-HRE-ODD-EGFP vector

[0029] Using pEGFP-N1 as template, EGFP-P1: 5'GCAGGATCCATGGTGAGCAAGGGCGAGGA3' (SEQ ID NO: 6); EGFP-P2: 5'GCAGCGGCCGCTTACTTGTACAGCTCGTCCA3' (SEQ ID NO: 7) as primer, PCR reaction was carried out for 30 cycles, after 1 % Gel electrophoresis, and the PCR fragment of EGFP was recovered with a gel recovery kit.

[0030] Take the PCR fragments of the vectors pVAX, pVAX-HRE, pVAX-HRE-ODD and EGFP respectively, carry out double digestion with BamH I and Not I, perform 1% gel electrophoresis, and recover pVAX and pVAX- HRE, pVAX-HRE-ODD and EGFP fragments. Mix pVAX, pVAX-HRE, pVAX-HRE-ODD vector fragments and EGFP fragments at a ratio of 1:3, add T4 ligase, react at 16°C for 16 hours, transform the reaction products into competent Escherichia coli DH5a, pick Successfully transformed colonies were identified by plasmid digestion (Figure 4). Positive clones were named pVAX-EGFP, pVAX-HRE-EGFP, pVAX-HRE-ODD-EGFP, respectively...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a novel eukaryotic gene construct. HRE is inserted in a promoter upstream, and ODD is inserted in front of an effector, thus resulting that the gene construct has rigid hypoxic targeting effect. The present invention also provides a carrier which contains the gene construct. In addition, the present invention relates to a drug combination which contains the gene construct.

Description

technical field [0001] The invention relates to the fields of genetic engineering and pharmacy. Specifically, it relates to a strict hypoxia targeting carrier and its application. Background technique [0002] Clinical studies have shown that hypoxia can cause a variety of cardiovascular and cerebrovascular diseases. Studies have shown the presence of hypoxic cells within malignant tumors. Many clinical evidences have shown that the presence of tumor hypoxic cells not only increases the resistance of tumors to radiotherapy and chemotherapy, but also makes tumors more aggressive and prone to distant metastasis. Under hypoxic conditions, the protein level of hypoxia-inducible factor-1 (HIF-1) produced by the nucleus increases, the binding activity with target genes increases, and its transcription is promoted, causing a series of cells to respond to hypoxia. Reaction. More than 60 HIF target genes have been discovered, all of which have hypoxia responsive element (HRE). H...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/79C12N15/12A61K48/00A61P35/00
Inventor王玉霞吴少平武军华贾培媛孙曼霁
OwnerINST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A