Lentiviral vector of fusion green fluorescent protein with over expression of RAB7A and EGFP genes, building method and application thereof
A green fluorescent protein and lentiviral vector technology, applied in the field of genetic engineering, can solve the problem of unclear detailed mechanism and achieve high-efficiency expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] The connection of embodiment 1EGFP gene and RAB7A gene
[0045] 1. Extract the total RNA of human renal tubular epithelial cells (HK-2), reverse transcribe the cDNA as a template, and use the cDNA as a template to amplify the RAB7 gene fragment by PCR. The primers used are: RAB7F:ATGACCTCTAGGAAGAAAG, RAB7R:TCAGCAACTGCAGCTTTCT, Amplification of the RAB7A gene. PCR reaction system:
[0046]
[0047] PCR amplification conditions: 95°C for 5min, 1cycle, 94°C for 40sc, 56°C for 45s, 72°C for 45s, 35cycles, 72°C for 10min, 1cycle. 1.5% agarose gel was recovered, introduced into the PMD-18T carrier, and the sequencing results were compared with the human RAB7A gene sequence on NCBI ( figure 1 with 2 ).
[0048] 2. Using primers B1F: GATAGGAATTCGCCACCATGGTGAGCAAGGGCGAGGAG and B1R: AGAGGTCATAGATCTGAGTCCGGACTTGTAC to amplify the EGFP gene using the PEGFP-C1 vector as a template. A BamHI restriction site was introduced at the 5' end of the B1F primer to amplify the EGFP g...
Embodiment 2
[0062] Example 2: The sequence of EGFP gene+SEQ ID NO: 1+RAB7A gene is connected to the LV11 vector
[0063] Using BamHI and EcoRI as restriction sites, the sequence of the EGFP+RAB7A gene was connected to the LV11 vector to obtain the recombinant plasmid of the overexpressed green fluorescent protein fused with RAB7A and EGFP. The EGFP+RAB7A gene fragment was first digested with BamHI and EcoRI, and digested at 37°C for 2 hours; then, the vector LV11 was digested with BamHI and EcoRI, and digested at 37°C for 2 hours. Electrophoresis, using a DNA gel recovery kit to recover the EGFP gene + SEQ ID NO: 1 + RAB7A gene fragment and the vector LV11. Use T4DNAligase to connect the EGFP+SEQ ID NO: 1+RAB7A gene fragment obtained by double enzyme digestion and the linearized vector, and connect at 22°C for 2 hours. The connection system is as follows:
[0064]
[0065] The ligation product was transformed into competent cells, and the bacteria were picked and cultured in a bacteri...
Embodiment 3
[0068] Example 3 RAB7A and EGFP overexpressed lentiviral vectors fused with green fluorescent protein transfected cells and functional studies in the study of cell autophagy and endocytosis and the functional role of RAB7A gene.
[0069] Infection test of HK-2 and 293T cells, 1) target cell plating: add 0.5×10 5 cells / well (adjusted according to cell type), 0.5ml DMEM medium containing 10% fetal bovine serum, 37°C, 5% CO 2 Overnight; 2) Dilute the virus: diluent (DMEM containing 2% fetal bovine serum) 400 μl + final concentration of 5 μg / ml transfection enhancer Polybrene, add the lentiviral stock solution (20-100 μl) to the diluent; 3) remove The original (DMEM medium containing 10% fetal bovine serum) cell culture medium, add the virus solution diluted in step 2), and establish a control (blank, negative) at the same time, 37 ° C, 5% CO 2 Overnight; 4) 12-24h, remove the virus liquid after cell infection, add 0.5ml DMEM medium containing 10% fetal bovine serum, 37°C, 5% CO ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
