Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lentiviral vector of fusion green fluorescent protein with over expression of RAB7A and EGFP genes, building method and application thereof

A green fluorescent protein and lentiviral vector technology, applied in the field of genetic engineering, can solve the problem of unclear detailed mechanism and achieve high-efficiency expression

Active Publication Date: 2015-04-22
SOUTHEAST UNIV
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As Rab7 localized in late endosomes or lysosomes, its function is closely related to the late transport of endosomes. Although many experiments currently support that Rab7 is involved in late endocytosis, the detailed mechanism is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentiviral vector of fusion green fluorescent protein with over expression of RAB7A and EGFP genes, building method and application thereof
  • Lentiviral vector of fusion green fluorescent protein with over expression of RAB7A and EGFP genes, building method and application thereof
  • Lentiviral vector of fusion green fluorescent protein with over expression of RAB7A and EGFP genes, building method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] The connection of embodiment 1EGFP gene and RAB7A gene

[0045] 1. Extract the total RNA of human renal tubular epithelial cells (HK-2), reverse transcribe the cDNA as a template, and use the cDNA as a template to amplify the RAB7 gene fragment by PCR. The primers used are: RAB7F:ATGACCTCTAGGAAGAAAG, RAB7R:TCAGCAACTGCAGCTTTCT, Amplification of the RAB7A gene. PCR reaction system:

[0046]

[0047] PCR amplification conditions: 95°C for 5min, 1cycle, 94°C for 40sc, 56°C for 45s, 72°C for 45s, 35cycles, 72°C for 10min, 1cycle. 1.5% agarose gel was recovered, introduced into the PMD-18T carrier, and the sequencing results were compared with the human RAB7A gene sequence on NCBI ( figure 1 with 2 ).

[0048] 2. Using primers B1F: GATAGGAATTCGCCACCATGGTGAGCAAGGGCGAGGAG and B1R: AGAGGTCATAGATCTGAGTCCGGACTTGTAC to amplify the EGFP gene using the PEGFP-C1 vector as a template. A BamHI restriction site was introduced at the 5' end of the B1F primer to amplify the EGFP g...

Embodiment 2

[0062] Example 2: The sequence of EGFP gene+SEQ ID NO: 1+RAB7A gene is connected to the LV11 vector

[0063] Using BamHI and EcoRI as restriction sites, the sequence of the EGFP+RAB7A gene was connected to the LV11 vector to obtain the recombinant plasmid of the overexpressed green fluorescent protein fused with RAB7A and EGFP. The EGFP+RAB7A gene fragment was first digested with BamHI and EcoRI, and digested at 37°C for 2 hours; then, the vector LV11 was digested with BamHI and EcoRI, and digested at 37°C for 2 hours. Electrophoresis, using a DNA gel recovery kit to recover the EGFP gene + SEQ ID NO: 1 + RAB7A gene fragment and the vector LV11. Use T4DNAligase to connect the EGFP+SEQ ID NO: 1+RAB7A gene fragment obtained by double enzyme digestion and the linearized vector, and connect at 22°C for 2 hours. The connection system is as follows:

[0064]

[0065] The ligation product was transformed into competent cells, and the bacteria were picked and cultured in a bacteri...

Embodiment 3

[0068] Example 3 RAB7A and EGFP overexpressed lentiviral vectors fused with green fluorescent protein transfected cells and functional studies in the study of cell autophagy and endocytosis and the functional role of RAB7A gene.

[0069] Infection test of HK-2 and 293T cells, 1) target cell plating: add 0.5×10 5 cells / well (adjusted according to cell type), 0.5ml DMEM medium containing 10% fetal bovine serum, 37°C, 5% CO 2 Overnight; 2) Dilute the virus: diluent (DMEM containing 2% fetal bovine serum) 400 μl + final concentration of 5 μg / ml transfection enhancer Polybrene, add the lentiviral stock solution (20-100 μl) to the diluent; 3) remove The original (DMEM medium containing 10% fetal bovine serum) cell culture medium, add the virus solution diluted in step 2), and establish a control (blank, negative) at the same time, 37 ° C, 5% CO 2 Overnight; 4) 12-24h, remove the virus liquid after cell infection, add 0.5ml DMEM medium containing 10% fetal bovine serum, 37°C, 5% CO ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lentiviral vector of fusion green fluorescent protein with over expression of RAB7A and EGFP genes, a building method and application thereof. The vector takes a lentiviral vector LV11 as a skeleton vector, wherein an EGFP gene segments and RAB7A gene segments are inserted behind a CMV promoter of the vector LV11 in a direction from 5' to 3'. By virtue of the lentiviral vector of fusion green fluorescent protein with over expression of RAB7A and EGFP genes, the problem that over-expression vector is effective and intuitive in the study of RAB7A genes can be solved. The vector takes CMV as the promoter, so that the high-efficiency expression of eukaryotic gene can be ensured; EGFP is used as a marker, the autophagy and endocytosis degree of cells and the effect of RAB7A genes in cell hypoxia process can be judged by intuitively observing the intensity of the expressed fluorescence; a good tool is provided for studying the functions of the RAB7A genes; the basis is provided for the subsequent correlation studies of RAB7A.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to the construction of a green fluorescent protein lentiviral vector for the overexpression fusion of RAB7A gene and EGFP gene, in particular to a lentiviral vector for the overexpression fusion of RAB7A gene and EGFP gene, and its construction and production in cells. Functional studies during phagocytosis and endocytosis. Background technique [0002] The Rab family is a class of RAS-related EGTP-binding proteins that play an important role in the regulation of vesicle transport. Rab protein acts as a molecular switch for vesicle transport. Its function is to interact with upstream regulators and downstream specific effectors, and to couple with the binding and hydrolysis of GTP. It is involved in the formation, transport, anchoring, and fusion of vesicles. important role in the process. [0003] Rab7 belongs to the Rab protein family (Ras-lik protein in rat brain, Rab), which m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N15/66C12Q1/68
Inventor 余文敏陈平圣王智丁粉干刘静刘蕾
Owner SOUTHEAST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com