Use of human heterogeneous substance metabolic enzymes gene mononucleotide polymorphism in diagnosing and treating systemic lupus erythematosus
A single nucleotide polymorphism, lupus erythematosus technology, applied in the direction of biochemical equipment and methods, microbial determination/inspection, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] Example 1: Detection of the newly discovered single nucleotide polymorphism site 51523T>G in the present invention
[0071] The present invention has newly discovered a single nucleotide polymorphism site 51523T>G located on intron 9 of the ABCG2 gene, and the method for detecting this site is introduced as follows:
[0072] The software Primer3 (http: / / frodo.wi.mit.edu / cgi-bin / primer3 / primer3) can be used to design some specific primers to search for polymorphic sites in related regions. The specificity of the designed primers relative to the human genome sequence was tested with the BLASTTM program (National Center for Biotechnology Information-http: / / www.ncbi.nlm.nih.gov / BLAST). Regardless of the forward or reverse primers, only when they find less than 5 similar sequences under the specific conditions of the BLAST program will they be considered specific and adopted.
[0073] with AmpliTaq Gold polymerase kit (Applied Biosystems, CA, USA) and Mastercycler Polym...
Embodiment 2
[0078] Example 2: Detection of SNPs associated with systemic lupus erythematosus on human ABCG2 and CYP2E1 genes
[0079] This example describes a method for detecting and identifying one or more of the SNPs described above. Partial target regions of the human ABCG2 gene and CYP2E1 gene will be used as templates to synthesize PCR products. Table 3 lists several pairs of specific primers, each pair can be used to amplify a specific target region.
[0080] Table 3: Primers for PCR and DNA sequencing of ABCG2 and CYP2E1 genes
[0081] single nucleotide polymorphism
site name
forward primer
reverse primer
Sequencing primers
optimal annealing temperature
Spend
51523T>G
rs2231148
CTACCACTCTCCCCAAAGCA (SEQ ID
NO: 2)
CGTGTGGTGGATGTCTGTA (SEQ ID
NO: 3)
SEQ ID NO: 2
60℃
rs8192772
GTTCTTGGTTTTTCCCAGCTCT (SEQ ID
NO: 5)
CTGAGTCTTCCCCATGCTACATAA (SEQ
ID NO: 6)
...
Embodiment 3
[0091] Example 3: A kit for detecting 51523T>G, rs2231148 of the ABCG2 gene and rs8192772 and rs2480256 of the CYP2E1 gene
[0092] This example describes a kit, which is used to detect and determine the sequence of one or several single nucleotide polymorphism sites mentioned above, so as to obtain the genotype of the tested individual. The test results can be used to predict the individual's susceptibility to systemic lupus erythematosus.
[0093] The kit contains the following primers: SEQ ID NO:2, SEQ ID NO:3, SED ID NO:5, SED ID NO:6, SED ID NO:8 and SED ID NO:9. The kit also contains the following reagents for PCR amplification of fragments of the ABCG2 and CYP2E1 genes: 1.5 mM magnesium ions, 200 μM four bases, positive control human template genomic DNA, and polymerase. When using the kit, the total volume of the polymerase chain reaction is 20 microliters, and the polymerase chain reaction is carried out using a thermal cycler according to the following steps: 95 deg...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap