Recombinant acetone-butanol clostridium and construction method and use thereof
A technology of Clostridium acetobutylicum and ATP synthase, which is applied in the direction of recombinant DNA technology, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of not being able to increase the production of butanol, and achieve the improvement of fermentation production rate and enhanced The effect of metabolic flux
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1, construct the Clostridium acetobutylicum expressing the hydrophilic part of FoF1 type ATP synthase
[0039] Using lysozyme, SDS and other reagents to destroy the conventional bacterial genome extraction method of the cell wall, extract the genomic DNA of Clostridium acetobutylicum (Clostridium acetobutylicum) ATCC 824 (American Type Culture Collection, U.S. Patent US7432090), according to the conventional PCR method, use The high-fidelity DNA polymerase Pfu amplifies the thiolase promoter region (Pthl) and the atpAGD gene coding region (the three genes atpA, atpG, and atpD are in one operon), and the primers are shown in Table 1.
[0040] Table 2. Nucleotide sequences of primers
[0041] Primer name sequence Restriction sites Pthl-F agt gtcgac tatattgataaaaataataatatagtggg Sal I
[0042] Pthl-R cgt ggatcc ttctttcattctaactaacctcc Bam H I at pAGD-F gtcc ggatcc atgaacataaaacctgaagagataacttcaataataaaaag ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 