Recombinant acetone-butanol clostridium and construction method and use thereof

A technology of Clostridium acetobutylicum and ATP synthase, which is applied in the direction of recombinant DNA technology, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of not being able to increase the production of butanol, and achieve the improvement of fermentation production rate and enhanced The effect of metabolic flux

Inactive Publication Date: 2009-05-06
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that overexpression of key enzyme genes in the butanol synthesis pathway (such as alcohol dehydrogenase gene adhE, butanol dehydrogenase bdh) does not increase the production of butanol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant acetone-butanol clostridium and construction method and use thereof
  • Recombinant acetone-butanol clostridium and construction method and use thereof
  • Recombinant acetone-butanol clostridium and construction method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, construct the Clostridium acetobutylicum expressing the hydrophilic part of FoF1 type ATP synthase

[0039] Using lysozyme, SDS and other reagents to destroy the conventional bacterial genome extraction method of the cell wall, extract the genomic DNA of Clostridium acetobutylicum (Clostridium acetobutylicum) ATCC 824 (American Type Culture Collection, U.S. Patent US7432090), according to the conventional PCR method, use The high-fidelity DNA polymerase Pfu amplifies the thiolase promoter region (Pthl) and the atpAGD gene coding region (the three genes atpA, atpG, and atpD are in one operon), and the primers are shown in Table 1.

[0040] Table 2. Nucleotide sequences of primers

[0041] Primer name sequence Restriction sites Pthl-F agt gtcgac tatattgataaaaataataatatagtggg Sal I

[0042] Pthl-R cgt ggatcc ttctttcattctaactaacctcc Bam H I at pAGD-F gtcc ggatcc atgaacataaaacctgaagagataacttcaataataaaaag ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant acetone butanol clostridium, a method for constructing the same and application thereof. The method for constructing the recombinant acetone butanol clostridium is to introduce a DNA fragment containing an encoding gene of a hydrophilic part of a FoF1 type ATP synthase into an acetone butanol clostridium to construct a recombinant bacterium. The invention also discloses a method for producing butanol, which is to ferment and culture the recombinant bacterium constructed by the method for constructing the recombinant acetone butanol clostridium to produce the butanol. The yield of butanol produced through fermenting the recombinant acetone butanol clostridium constructed by the invention can reach as high as 13.7 grams per liter.

Description

technical field [0001] The invention relates to recombinant Clostridium acetobutylicum and its construction method and application. Background technique [0002] With the continuous reduction of petroleum resources and the rising price of non-renewable resources, the development and utilization of environmentally friendly bio-based products has become a strategic demand for transforming the mode of economic growth, ensuring a virtuous cycle of the ecological chain, and achieving sustainable economic and social development. Butanol is an important chemical raw material, mainly used in the manufacture of plasticizers, solvents and extractants. Butanol is a new biofuel with great potential. Its calorific value and octane number are equivalent to those of gasoline; its oxygen content is similar to that of methyl tert-butyl ether commonly used in gasoline; it will not corrode pipelines and is convenient for pipeline transportation; Low steam pressure, high safety, and can be mix...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/52C12N9/00C12P7/16C12R1/145
Inventor董红军张延平李寅
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI