Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of anti-atherosclerosis epitope composition, its preparation method and application

A technology of atherosclerosis and composition, which is applied in the field of biopharmaceuticals, can solve the problems that it is not easy to establish a stable and simple production process, and the requirements for preparation conditions are high, and achieve the effects of avoiding degradation problems, avoiding side effects, and reducing impact

Inactive Publication Date: 2012-02-01
CHINA PHARM UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the pathogenesis of different autoimmune diseases is different, and the effect of autoantigens on the disease under different immune conditions may also be completely different, so it is possible to prevent atherosclerosis by using mHSP65 whole molecule immunization to prevent other autoimmune diseases. adverse effects, a large number of experiments are needed to evaluate its safety; secondly, the mHSP65 molecule has the catalytic activity of protease, which is easily decomposed by its own protease activity during the preparation process, and its preparation conditions are relatively high, so it is not easy to establish a stable and simple Production Process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of anti-atherosclerosis epitope composition, its preparation method and application
  • A kind of anti-atherosclerosis epitope composition, its preparation method and application
  • A kind of anti-atherosclerosis epitope composition, its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Such as figure 1 Shown, the principle of the present invention is: according to cholera toxin B subunit (CTB) usually exists in the form of pentamers, it depolymerizes into monomers under denaturing conditions, and can re-aggregate during renaturation. A carrier molecule for each epitope is used. The selected epitopes are divided into 1-5 groups and fused in series to the C-terminal of CTB to form a new fusion protein. After separation and purification, the fusion protein is mixed and renatured to obtain an epitope composition by using the self-polymerization ability of CTB. In addition, the aggregation of cholera toxin B subunit multi-molecules can also effectively enhance the immunostimulatory ability of the presented epitope, and the epitope composition can bind to the ganglioside (GM1) receptor on the mucosal surface through CTB when administered through the mucosa On the surface, it is beneficial to the function of the epitope composition. Epitope scanning studie...

Embodiment 2

[0111] Prepare an epitope composition composed of 3 epitopes under the same materials and conditions as in Example 1

[0112] 1. Prepare an epitope composition consisting of three epitopes

[0113] (a) Extract epitopes:

[0114] Same as in Example 1, three epitopes (1) to (3) were selected from the epitopes in mHSP65 with characteristics of atherosclerotic autoimmune antigens to study the epitope composition. The epitopes in this group were The total number of amino acids is ≤75.

[0115] (b) Construction of recombinant plasmids:

[0116] First construct the pET28a-CTB recombinant plasmid, and design two primers P1 and P2 with the help of computer software. The nucleotide sequences of the two primers are as follows:

[0117] P1: 5'GGGTCATGACACCTCAAAAATATTACTG 3'

[0118] P2: 5'AAAGCTAGCATTTGCCATACTAATTGCGGCAATCGC 3'

[0119] The NcoI isotailase PagI restriction site was introduced into primer P1, and the NheI restriction site was introduced into primer P2. Primers were s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an epitope composition, its preparation method and use, in particular to an anti-atherosclerosis epitope composition, its preparation method and use, and belongs to the technical field of biopharmaceuticals. The epitope composition of the present invention includes 15 epitopes in M. bovis heat shock protein 65 that are characteristic of atherosclerotic autoimmune antigens. The beneficial effect is: by combining the epitopes with atherosclerotic autoimmune antigen characteristics in multiple mHSP65 molecules, the obtained epitope composition can fully exert the immune effect similar to the whole mHSP65 molecule; The epitope characteristic of atherosclerotic autoimmune antigens avoids the use of the whole molecule, reduces the impact on other autoimmune diseases, and avoids potential side effects; avoids the degradation problem caused by the protease activity of the whole mHSP65 molecule itself, making the process more stable and feasible.

Description

technical field [0001] The invention relates to an epitope composition, its preparation method and application, especially an anti-atherosclerosis epitope composition, its preparation method and application, and belongs to the technical field of biopharmaceuticals. Background technique [0002] Atherosclerosis (atherosclerosis) is a common disease that seriously endangers human health. In recent years, the incidence in my country has shown a trend of increasing year by year. At present, atherosclerosis is no longer simply recognized as the result of lipid deposition in large and medium-sized arterial walls, but a vascular disease caused by abnormal lipid metabolism, blood coagulation disorders, and genetic, environmental, and microbial infections. A disease process caused by a combination of chronic inflammation. The involvement of lymphocytes and inflammatory factors has been observed in human atherosclerosis in all stages of lesions. With the identification of its related...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/35
Inventor 刘景晶熊祺琰孙云霄王华倩贾绍辉邓双玲曹荣月李泰明金亮吴洁
Owner CHINA PHARM UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More