A kind of anti-atherosclerosis epitope composition, its preparation method and application
A technology of atherosclerosis and composition, which is applied in the field of biopharmaceuticals, can solve the problems that it is not easy to establish a stable and simple production process, and the requirements for preparation conditions are high, and achieve the effects of avoiding degradation problems, avoiding side effects, and reducing impact
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Such as figure 1 Shown, the principle of the present invention is: according to cholera toxin B subunit (CTB) usually exists in the form of pentamers, it depolymerizes into monomers under denaturing conditions, and can re-aggregate during renaturation. A carrier molecule for each epitope is used. The selected epitopes are divided into 1-5 groups and fused in series to the C-terminal of CTB to form a new fusion protein. After separation and purification, the fusion protein is mixed and renatured to obtain an epitope composition by using the self-polymerization ability of CTB. In addition, the aggregation of cholera toxin B subunit multi-molecules can also effectively enhance the immunostimulatory ability of the presented epitope, and the epitope composition can bind to the ganglioside (GM1) receptor on the mucosal surface through CTB when administered through the mucosa On the surface, it is beneficial to the function of the epitope composition. Epitope scanning studie...
Embodiment 2
[0111] Prepare an epitope composition composed of 3 epitopes under the same materials and conditions as in Example 1
[0112] 1. Prepare an epitope composition consisting of three epitopes
[0113] (a) Extract epitopes:
[0114] Same as in Example 1, three epitopes (1) to (3) were selected from the epitopes in mHSP65 with characteristics of atherosclerotic autoimmune antigens to study the epitope composition. The epitopes in this group were The total number of amino acids is ≤75.
[0115] (b) Construction of recombinant plasmids:
[0116] First construct the pET28a-CTB recombinant plasmid, and design two primers P1 and P2 with the help of computer software. The nucleotide sequences of the two primers are as follows:
[0117] P1: 5'GGGTCATGACACCTCAAAAATATTACTG 3'
[0118] P2: 5'AAAGCTAGCATTTGCCATACTAATTGCGGCAATCGC 3'
[0119] The NcoI isotailase PagI restriction site was introduced into primer P1, and the NheI restriction site was introduced into primer P2. Primers were s...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com