Anti-atherosis epitope composition, preparation method and uses thereof

A technology of atherosclerosis and composition, which is applied in the field of biopharmaceuticals, can solve the problems of high requirements for preparation conditions, difficulty in establishing a stable and simple production process, etc., and achieve the effect of avoiding side effects, avoiding degradation problems, stable and feasible process

Inactive Publication Date: 2009-05-13
CHINA PHARM UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the pathogenesis of different autoimmune diseases is different, and the effect of autoantigens on the disease under different immune conditions may also be completely different, so it is possible to prevent atherosclerosis by using mHSP65 whole molecule immunization to prevent other autoimmune diseases. adverse effects, a large

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-atherosis epitope composition, preparation method and uses thereof
  • Anti-atherosis epitope composition, preparation method and uses thereof
  • Anti-atherosis epitope composition, preparation method and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0041] Example 1

[0042] like figure 1 As shown, the principle of the present invention is: according to the characteristic that cholera toxin B subunit (CTB) usually exists in the form of pentamers, depolymerizes into monomers under denaturing conditions, and can re-aggregate during renaturation, it is used as a help to combine many epitope carrier molecules are used. The selected epitopes are divided into 1-5 groups and fused to the C-terminus of CTB in series to form a new fusion protein. After separation and purification, the self-polymerization ability of CTB is used to mix and renature the fusion protein to obtain an epitope composition. In addition, the aggregation of cholera toxin B subunit polymolecules can also effectively enhance the immunostimulatory ability of the presented epitope, and the epitope composition can be directed to bind to the ganglioside (GM1) receptor on the mucosal surface through CTB through mucosal administration. It is beneficial to the exer...

Example Embodiment

[0109] Embodiment 2

[0110] Prepare an epitope composition composed of 3 epitopes under the same materials and conditions as in Example 1 1. Prepare an epitope composition composed of 3 epitopes

[0111] (a) Extracting epitopes:

[0112] Similar to Example 1, a total of 3 epitopes (1) to (3) were selected from the epitopes with atherosclerotic autoimmune antigen characteristics in mHSP65 to study the epitope composition. The total number of amino acids is less than or equal to 75.

[0113] (b) Construction of recombinant plasmid:

[0114] First, construct the pET28a-CTB recombinant plasmid, and design two primers P1 and P2 with the help of computer software. The nucleotide sequences of the two primers are as follows:

[0115] P1: 5'GGGTCATGACACCTCAAAATATTACTG3'

[0116] P2: 5'AAAGCTAGCATTTGCCATACTAATTGCGGCAATCGC3'

[0117] Primer P1 introduced the NcoI homozygous enzyme PagI restriction site, and primer P2 introduced the NheI restriction site. Primers were synthesized b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an epitope composition, as well as a preparation method and uses thereof, in particular to an anti-atherosclerosis epitope composition, as well as a preparation method and uses thereof, which belongs to the technical field of biopharmacy. The epitope composition comprises fifteen epitopes having the characteristics of atherosclerosis autoimmune antigen in Mycobacterium bovine heat shock protein 65. The invention has the advantages that the obtained epitope composition can give full play to the immune efficacy of molecules similar to all-mHSP65 molecules by combining the epitopes having the characteristics of the atherosclerosis autoimmune antigen in a plurality of mHSP65 molecules; in addition, the epitopes having the characteristics of the atherosclerosis autoimmune antigen are chosen and the use of all-molecules is avoided, thereby reducing the influence on other autoimmune diseases, avoiding potential side effects, avoiding degradation problems brought by the own protease activity of the all-mHSP65 molecules and ensuring more stable and feasible process.

Description

technical field [0001] The invention relates to an epitope composition, its preparation method and application, especially an anti-atherosclerosis epitope composition, its preparation method and application, and belongs to the technical field of biopharmaceuticals. Background technique [0002] Atherosclerosis (atherosclerosis) is a common disease that seriously endangers human health. In recent years, the incidence in my country has shown a trend of increasing year by year. At present, atherosclerosis is no longer simply recognized as the result of lipid deposition in large and medium-sized arterial walls, but a vascular disease caused by abnormal lipid metabolism, blood coagulation disorders, and genetic, environmental, and microbial infections. A disease process caused by a combination of chronic inflammation. The involvement of lymphocytes and inflammatory factors has been observed in human atherosclerosis in all stages of lesions. With the identification of its related...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/35C07K7/08C12N15/62C12N15/70A61K38/10A61K38/16A61P9/10
Inventor 刘景晶熊祺琰王华倩孙云霄贾绍辉邓双玲曹荣月李泰明金亮吴洁
Owner CHINA PHARM UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap