A cDNA sequence of Tamarix androssowii ferritin gene and encoded amino acid sequence
A ferritin gene and ferritin technology are applied in the field of the cDNA of the tamarind gene and the polypeptide encoded by it to achieve the effects of increasing plant height and fresh weight, improving utilization efficiency, and improving the ability to absorb and store iron ions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
specific Embodiment approach 1
[0012] Specific embodiment one: In this embodiment, the total length of the cDNA gene of Tamarin ferritin is 1179bp, and the gene sequence is:
[0013] ACTTATCTATCAATTTCAAACCGTCGAACTCCTGAATTTACCCCGTTGTGAGAGAAAGGTCAATAACACTATGCTTCTCAAGGGCGCTGCCGCTGCTTCTACTTTTTCATACTTCGCCGCTACCAGTGCTGAAAATCAGGTTACCTGTGCACAATCGTTGAGCGGTTCAGTCAGGTTTTCATCGCCGAGTAATGGAAGAAGATTGGTGGTTTCTGCATCTGCTCCGGAGGCGAATAATAGGCCTCTGACCGGTGTTGTTTTTAAGCCGTTTGAAGAGGTTAAGAAAGAGCTTCAAATGGTTCCAACTCTACCGCAGGTTTCACTTGCTCGTCAGAAGTTTGTTGATGAGTGTGAAGCTGCCATTAATGAGCAGATTAACGTGGAGTATAATGTATCATATGTTTATCACGCCATGTATGCTTACTTTGATCGGGATAATGTCGCACTGAAGGGGCTCGCTAAGTTTTTCAAGGAATCAAGTTTGGAGGAAAGGGAGCACGCTGAAAAGCTTATGGAATATCAGAACAAGCGTGGTGGTAGAGTGAAGTTGCAGTCCATTGTGATGCCTCTGTCTGAGTTCGATCATATGGAGAAAGGAGATGCTCTATACGCTATGGAGCTTGCTTTGTCCTTGGAGAAGCTTACTAATGAGAAATTATTGAACCTTCACCATGTTGCGGAGGAAAACCATGATGTTCAGTTGCAAGAATTTATTGAAGGCGAATATTTGAGTGAGCAGGTGGATGCTATCAAGAAAATATCCGAATATGTTGCTCAGCTCAGAAGAATTGGCAAAGGACACGGGGTGTGGCATTTCGATCAAATGCTTCTTCACGGGGATG...
specific Embodiment approach 2
[0017] Specific embodiment 2: The difference between this embodiment and specific embodiment 1 is that the cDNA sequence of Tamarin ferritin gene contains the 5' end untranslated region 1bp-70bp, the protein coding region 71bp-868bp and the 3' end untranslated region 869bp -1179bp. Others are the same as in the first embodiment.
specific Embodiment approach 3
[0018] Specific embodiment three: the amino acid sequence encoded by the cDNA sequence of the tamarin ferritin gene of the present embodiment includes 265 amino acids, and the amino acid sequence encoded by the tamarin ferritin gene is:
[0019]MLLKGAAAASTFSYFAATSAENQVTCAQSLSGSVRFSSPSNGRRLVVSASAPEANNRPLTGVVFKPFEEVKKELQMVPTLPQVSLARQKFVDECEAAINEQINVEYNVSYVYHAMYAYFDRDNVALKGLAKFFKESSLEEREHAEKLMEYQNKRGGRVKLQSIVMPLSEFDHMEKGDALYAMELALSLEKLTNEKLLNLHHVAEENHDVQLQEFIEGEYLSEQVDAIKKISEYVAQLRRIGKGHGVWHFDQMLLHGDAVADGAAA。
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More