Supercharge Your Innovation With Domain-Expert AI Agents!

A cDNA sequence of Tamarix androssowii ferritin gene and encoded amino acid sequence

A ferritin gene and ferritin technology are applied in the field of the cDNA of the tamarind gene and the polypeptide encoded by it to achieve the effects of increasing plant height and fresh weight, improving utilization efficiency, and improving the ability to absorb and store iron ions

Inactive Publication Date: 2011-04-13
NORTHEAST FORESTRY UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The object of the present invention is to solve the problem that the iron ion concentration is low in arid or semi-arid soil and cannot meet the needs of plant growth, and provide the cDNA sequence of the tamarind ferritin gene and amino acid sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0012] Specific embodiment one: In this embodiment, the total length of the cDNA gene of Tamarin ferritin is 1179bp, and the gene sequence is:

[0013] ACTTATCTATCAATTTCAAACCGTCGAACTCCTGAATTTACCCCGTTGTGAGAGAAAGGTCAATAACACTATGCTTCTCAAGGGCGCTGCCGCTGCTTCTACTTTTTCATACTTCGCCGCTACCAGTGCTGAAAATCAGGTTACCTGTGCACAATCGTTGAGCGGTTCAGTCAGGTTTTCATCGCCGAGTAATGGAAGAAGATTGGTGGTTTCTGCATCTGCTCCGGAGGCGAATAATAGGCCTCTGACCGGTGTTGTTTTTAAGCCGTTTGAAGAGGTTAAGAAAGAGCTTCAAATGGTTCCAACTCTACCGCAGGTTTCACTTGCTCGTCAGAAGTTTGTTGATGAGTGTGAAGCTGCCATTAATGAGCAGATTAACGTGGAGTATAATGTATCATATGTTTATCACGCCATGTATGCTTACTTTGATCGGGATAATGTCGCACTGAAGGGGCTCGCTAAGTTTTTCAAGGAATCAAGTTTGGAGGAAAGGGAGCACGCTGAAAAGCTTATGGAATATCAGAACAAGCGTGGTGGTAGAGTGAAGTTGCAGTCCATTGTGATGCCTCTGTCTGAGTTCGATCATATGGAGAAAGGAGATGCTCTATACGCTATGGAGCTTGCTTTGTCCTTGGAGAAGCTTACTAATGAGAAATTATTGAACCTTCACCATGTTGCGGAGGAAAACCATGATGTTCAGTTGCAAGAATTTATTGAAGGCGAATATTTGAGTGAGCAGGTGGATGCTATCAAGAAAATATCCGAATATGTTGCTCAGCTCAGAAGAATTGGCAAAGGACACGGGGTGTGGCATTTCGATCAAATGCTTCTTCACGGGGATG...

specific Embodiment approach 2

[0017] Specific embodiment 2: The difference between this embodiment and specific embodiment 1 is that the cDNA sequence of Tamarin ferritin gene contains the 5' end untranslated region 1bp-70bp, the protein coding region 71bp-868bp and the 3' end untranslated region 869bp -1179bp. Others are the same as in the first embodiment.

specific Embodiment approach 3

[0018] Specific embodiment three: the amino acid sequence encoded by the cDNA sequence of the tamarin ferritin gene of the present embodiment includes 265 amino acids, and the amino acid sequence encoded by the tamarin ferritin gene is:

[0019]MLLKGAAAASTFSYFAATSAENQVTCAQSLSGSVRFSSPSNGRRLVVSASAPEANNRPLTGVVFKPFEEVKKELQMVPTLPQVSLARQKFVDECEAAINEQINVEYNVSYVYHAMYAYFDRDNVALKGLAKFFKESSLEEREHAEKLMEYQNKRGGRVKLQSIVMPLSEFDHMEKGDALYAMELALSLEKLTNEKLLNLHHVAEENHDVQLQEFIEGEYLSEQVDAIKKISEYVAQLRRIGKGHGVWHFDQMLLHGDAVADGAAA。

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a cDNA of Tamarix androssowii ferritin gene and an encoded polypeptide thereof. The invention settles a problem that the growing requirement of plant growth can not be satisfied because of low concentration of iron ions in the dry or half-dry soil. The total length of Tamarix androssowii ferritin gene according to the invention is 1179bp, and the gene sequence of Tamarix androssowii ferritin gene is shown in SEQ ID No.1. The amino acid sequence of ferritin gene is shown in SEQ ID No.2. The ferritin gene can increase the iron ion content of transgenic tobacco for more than 20% when introduced into the tobacco. The gene can increase the utilization efficiency of iron ions by transgenic plant, and the requirement of plant growth is satisfied.

Description

technical field [0001] The present invention relates to the cDNA sequence of the ferritin gene and the encoded amino acid sequence. Background technique [0002] Iron is an essential element for plant growth and development. Although the soil is rich in iron, it usually exists in the form of stable oxides in arid or semi-arid soils, and its equilibrium concentration is only 10-17 μmol / L, which is far from meeting the needs of plant growth. Iron deficiency will affect the activity of plant redox enzymes and the normal transfer of electrons in the photosynthetic and respiratory transport chains, and also lead to the blockage of chlorophyll synthesis, affecting the normal growth and production of plants. Contents of the invention [0003] The purpose of the present invention is to solve the problem that the iron ion concentration is low in arid or semi-arid soil and cannot meet the needs of plant growth, and provide the cDNA sequence and amino acid sequence of the tamarin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415
Inventor 姜廷波周博如王玉成王雷曲跃军丁宝建
Owner NORTHEAST FORESTRY UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More