Bridge molecule 1-siRNA interference sequence and fusion expression vector thereof
A technology of fusion expression and interference sequence, which is applied in the direction of DNA/RNA fragments, recombinant DNA technology, and the use of vectors to introduce foreign genetic materials.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] 1. Sources of experimental materials:
[0020] Human malignant glioma cell line LN-229 was provided by the University of Texas MD Anderson Cancer Center, the chemotaxis chamber was purchased from Neuro Probe, EGF was purchased from Peprotech, intersectin1 antibody was from Abcam, and G418 was purchased from Invitrogen company.
[0021] 2. Design and synthesis of intersectin1-siRNA
[0022] Design specific intersectin1-siRNA based on the siRNA design software provided by Ambion on the Internet, and synthesize the following templates by Shanghai Gemma Pharmaceutical Technology Co., Ltd., with BamH I and Bbs I restriction sites at both ends, and siRNA action sites: 5'-GGCTGGCTTGGAGGAGAATTA-3'.
[0023] Query 1 GGCTGGCTTGGAGGAGAATTA 21
[0024] ||||||||||||||||||||||
[0025] Sbjct 2615 GGCTGGCTTGGAGGAGAATTA 2635
[0026] 2581 ggaatgggtg gatgaaagcc aaactggaga acccggctgg cttggaggag aattaaagg
[0027] 2641 aaagacaggg tggttccctg caaactatgc agagaaaatc ccagaaaat...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap