Fusion protein of ribonuclease and toxalbumin membrane transposition structural domain, preparation and application thereof

A technology of ribonuclease and fusion protein, which is applied in the field of DNA recombination technology and biomedicine, and can solve the problems of limiting the scope of application of Onc and different sensitivities.

Active Publication Date: 2009-12-30
SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, further studies have found that different tumor cells have different sensitivities to Onc (Ulrich Arnold & Renate Ulbrich-Hofmann. Natural and engineered ribonucleases apotential cancer therapeutics. Biotechnol Lett (2006) 28: 1615-1622)
This greatly limits the scope of application of Onc in tumor therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of ribonuclease and toxalbumin membrane transposition structural domain, preparation and application thereof
  • Fusion protein of ribonuclease and toxalbumin membrane transposition structural domain, preparation and application thereof
  • Fusion protein of ribonuclease and toxalbumin membrane transposition structural domain, preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0120] Embodiment 1Onc-DT 203-390 Synthesis of fusion gene and construction of expression plasmid in Escherichia coli

[0121] To facilitate Onc-DT 203-390 Released from the endosome to the cytoplasm, connect Onc and DT with a 16-amino acid linker peptide containing a furin restriction site. The DNA sequence of furin-DT is a whole gene synthesis. In order to facilitate PCR, Onc and furin- The DT sequences were connected, and 25 Onc terminal base sequences were added to the furin 5' end during the whole gene synthesis. See SEQ ID NO:3 for the synthetic sequence of the whole gene. The following pair of primers were designed and synthesized according to the gene sequences of Onc and DT:

[0122] Onc-DT-U (SEQ ID NO: 4):

[0123] 5'CCCAGGACTGGCTGACTTTCCA 3';

[0124] Onc-DT-L (SEQ ID NO: 5):

[0125] 5' GGGTCGACTTATTCCGGACCACCAGAAGC 3'.

[0126] Wherein, Onc-DT-U is the coding sequence of the N-terminal of Onc mature protein; Onc-DT-L is the reverse complementary sequence o...

Embodiment 2

[0128] Embodiment 2Onc-DT 203-390 Expression of fusion protein

[0129] The constructed expression plasmid was transformed into Escherichia coli BL21(DE3), and a single clone was picked overnight in 50ml LB medium and cultured overnight at 37°C. The next day, transfer 1L of TB medium at a ratio of 1:20, and culture at 37°C until A 600 =2.0, add IPTG concentration to 0.5mM to induce for 3.5 hours, collect the bacterial cells by centrifugation at 4°C, 6000rpm×10min, and the bacterial cells are used for the next step of inclusion body collection and purification.

Embodiment 3

[0130] Example 3 Inclusion Body Collection and Washing

[0131] Suspend the collected bacteria in buffer SSB_A (20mM Tris-HCl, 10mM EDTA, pH 8.0), break the bacteria with an ultrasonic breaker; centrifuge at 12000rpm×10min at 4°C to collect inclusion bodies; HCl, 1M guanidine hydrochloride, 65mM DTT, 2mM EDTA, pH 8.0) to suspend inclusion bodies, stir overnight, collect inclusion bodies at 4°C, 12000rpm×10min.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fusion protein of ribonuclease (Onc) and bacterial toxalbumin membrane transposition structural domain. The DNA sequence coding the fusion protein contains a vector of the DNA sequence, a host cell containing the vector and a method for preparing the fusion protein by adopting genetic engineering. The fusion protein not only has the activity of the original Onc, but also has stronger capability of killing tumor cells, and can be more widely applied to the anti-tumor treatment.

Description

technical field [0001] The invention belongs to the field of DNA recombination technology and biomedicine. More specifically, the present invention relates to a fusion protein of ribonuclease and bacterial toxin (toxin) membrane translocation domain, a DNA sequence encoding the fusion protein, a vector containing the DNA sequence, a host cell containing the vector, and the use of a gene A method for preparing the fusion protein by engineering technology, and the application of the fusion protein in tumor therapy. Background technique [0002] Ribonuclease (Onconase, also known as: P30 protein, Ranpirnase, Onc for short) is a nuclease isolated from oocytes and early embryos of the northern leopard frog (Rana pipiens), and belongs to the RNaseA superfamily. Studies have shown that Onc enters mammalian cells through endocytosis, selectively degrades tRNA in the cytoplasm, inhibits protein biosynthesis, thereby inhibiting cell proliferation and causing cell apoptosis. In vitro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12P21/02A61K38/16A61P35/00
CPCC12N9/22A61K38/00C07K14/195A61P35/00
Inventor王庆诚沈如凌孙瑞林费俭李俊
OwnerSHANGHAI BIOMODEL ORGANISM SCI & TECH DEV