Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Polynucleotide

A technology for multiple sclerosis, the use of which is applied in the field of polynucleotides, which can solve the problem of pathological causes of neurodegenerative diseases without treatment

Inactive Publication Date: 2010-03-17
THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV
View PDF17 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a result, there are currently no treatments targeting the primary pathological cause of any neurodegenerative disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polynucleotide
  • Polynucleotide
  • Polynucleotide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0151] Polynucleotide therapy involves the administration of DNA encoding the self-protein PLP, used to prevent multiple sclerosis animal model

[0152] PLP self-vector Polynucleotides encoding PLP self-protein epitopes were constructed by annealing two oligonucleotides with 16-mer overlapping complementary sequences (underlined), extended with DNA polymerase and dNTPs:

[0153] PLP(139-151):

[0154] 5'-CTCGAGACCATGCATTGTTTGGGA AAATGGCTAGGACAT CCCGACAAGTTTTTCTAGATAGCTA-3';

[0155] PLP(139-151)L144 / R147:

[0156] 5'CTCGAGACCATGCATTGTTTGGGA AAACTACTAGGACGC CCCGACAAGTTTTTCTAGATAGCTA-3'

[0157] These oligonucleotide duplexes were designed to contain XhoI and XbaI restriction sites. The product was cloned into the multiple cloning region of the pTATGET vector (Promega, Madison, WI), a CMV promoter driven mammalian expression vector. Positive clones were identified by color screening and insertions in the correct orientation were confirmed by automated DNA sequencing....

Embodiment 2

[0163] Polynucleotide therapy involves the administration of DNA encoding multiple self-proteins for the treatment of multiple sclerosis animal model

[0164] The same approach described in Example 1 was used to demonstrate that vectors containing DNA encoding the four major myelin autoproteins, MBP, MOG, MAG, and PLP, were even more effective than DNA encoding a single self-peptide in the treatment of established, ongoing, and relapsing EAE , EAE is the most typical animal model for human MS (Tables 5 and 6).

[0165] table 5

[0166]

[0167] Self-vectors containing DNA encoding multiple self-proteins were administered intramuscularly to mice once a week at a dose of 50 μg of each of the four vectors encoding MBP, MOG, MAG and PLP. Initiate treatment after recovery from the onset acute episode of EAE (eg, after recovery from the first clinically paralyzing episode after disease induction). The rate of deterioration represents the amount of clinical paralysis that oc...

Embodiment 3

[0169] Polynucleotide therapy involves the administration of DNA encoding self-peptides or self-proteins plus cytokine-encoding DNA, an animal model for treating multiple sclerosis

[0170] Following the method described in Example 1, the modification is that the self-vector encodes PLP self-peptide or multiple myelin proteins. A DNA expression construct encoding the cytokine IL-4 was administered simultaneously. DNA therapy further enhanced the protective effect by administering self-vectors encoding myelin self-peptides or myelin self-proteins, in combination with DNA encoding the cytokine IL-4 (Table 6).

[0171] Table 6

[0172]

[0173] DNA therapy was administered intramuscularly to mice once a week at a dose of 25 μg of each of the four DNA plasmids encoding MBP, MOG, MAG and PLP. All other DNAs were given weekly at a dose of 50 μg plasmid per animal. Initiate treatment after recovery from the onset acute episode of EAE (eg, after recovery from the first clini...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention provides a method of treating or preventing a disease in an animal associated with one or more self-protein(s), -polypeptide(s), or -peptide(s) that is present or involved in a non-physiologic process in the animal comprising administering to the animal a self-vector comprising a polynucleotide encoding the self-protein(s), -polypeptide(s) or -peptide(s) associated with the disease.Administration of the self-vector comprising a polynucleotide encoding the self-protein(s), -polypeptide(s) or -peptide(s) modulates an immune response to the self-protein(s), -polypeptide(s) or -peptide(s) expressed from administration of the self-vector. The invention also provides a composition comprising a polynucleotide encoding one or more self-protein(s), -polypeptide(s), or -peptide(s) that is present non-physiologically in a treated animal useful in treating or preventing a disease associated with the self-protein(s), -polypeptide(s), or -peptide(s) present in and / or the target of anon-physiologic process in the animal.

Description

[0001] This application is a divisional application of an invention patent application with the international application number PCT / US02 / 37686, the international application date is November 21, 2002, the application number 02827318.4, which has entered the Chinese national phase, and the name is "polynucleotide therapy". . technical field [0002] The present invention relates to methods and compositions for treating a disease in a subject associated with one or more self-proteins, polypeptides or peptides present in the subject or involved in a non-physiological state. The present invention also relates to methods and compositions for preventing a disease in a subject associated with one or more self-proteins, polypeptides or peptides present in the subject or involved in a non-physiological state. The present invention further relates to the identification of self-proteins, polypeptides or peptides present in non-physiological states and associated with disease. The inven...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K39/00A61P25/28C12N15/09A61K38/20A61P1/16A61P3/04A61P3/10A61P19/00A61P19/02A61P25/00A61P25/16A61P29/00A61P37/00
CPCA61K39/0008A61K2039/55522A61K39/0007A61K2039/55561A61K2039/53A61K38/2026A61K48/00A61K39/001C07K2319/30A61P1/16A61P19/00A61P19/02A61P21/00A61P25/00A61P25/16A61P25/28A61P29/00A61P3/04A61P37/00A61P37/02A61P37/06A61P43/00A61P5/48A61P7/12A61P3/10
Inventor P·方托拉H·加伦W·H·罗宾逊L·斯坦恩曼P·J·鲁伊兹P·J·尤茨
Owner THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com