Polynucleotide
A technology for multiple sclerosis, the use of which is applied in the field of polynucleotides, which can solve the problem of pathological causes of neurodegenerative diseases without treatment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0151] Polynucleotide therapy involves the administration of DNA encoding the self-protein PLP, used to prevent multiple sclerosis animal model
[0152] PLP self-vector Polynucleotides encoding PLP self-protein epitopes were constructed by annealing two oligonucleotides with 16-mer overlapping complementary sequences (underlined), extended with DNA polymerase and dNTPs:
[0153] PLP(139-151):
[0154] 5'-CTCGAGACCATGCATTGTTTGGGA AAATGGCTAGGACAT CCCGACAAGTTTTTCTAGATAGCTA-3';
[0155] PLP(139-151)L144 / R147:
[0156] 5'CTCGAGACCATGCATTGTTTGGGA AAACTACTAGGACGC CCCGACAAGTTTTTCTAGATAGCTA-3'
[0157] These oligonucleotide duplexes were designed to contain XhoI and XbaI restriction sites. The product was cloned into the multiple cloning region of the pTATGET vector (Promega, Madison, WI), a CMV promoter driven mammalian expression vector. Positive clones were identified by color screening and insertions in the correct orientation were confirmed by automated DNA sequencing....
Embodiment 2
[0163] Polynucleotide therapy involves the administration of DNA encoding multiple self-proteins for the treatment of multiple sclerosis animal model
[0164] The same approach described in Example 1 was used to demonstrate that vectors containing DNA encoding the four major myelin autoproteins, MBP, MOG, MAG, and PLP, were even more effective than DNA encoding a single self-peptide in the treatment of established, ongoing, and relapsing EAE , EAE is the most typical animal model for human MS (Tables 5 and 6).
[0165] table 5
[0166]
[0167] Self-vectors containing DNA encoding multiple self-proteins were administered intramuscularly to mice once a week at a dose of 50 μg of each of the four vectors encoding MBP, MOG, MAG and PLP. Initiate treatment after recovery from the onset acute episode of EAE (eg, after recovery from the first clinically paralyzing episode after disease induction). The rate of deterioration represents the amount of clinical paralysis that oc...
Embodiment 3
[0169] Polynucleotide therapy involves the administration of DNA encoding self-peptides or self-proteins plus cytokine-encoding DNA, an animal model for treating multiple sclerosis
[0170] Following the method described in Example 1, the modification is that the self-vector encodes PLP self-peptide or multiple myelin proteins. A DNA expression construct encoding the cytokine IL-4 was administered simultaneously. DNA therapy further enhanced the protective effect by administering self-vectors encoding myelin self-peptides or myelin self-proteins, in combination with DNA encoding the cytokine IL-4 (Table 6).
[0171] Table 6
[0172]
[0173] DNA therapy was administered intramuscularly to mice once a week at a dose of 25 μg of each of the four DNA plasmids encoding MBP, MOG, MAG and PLP. All other DNAs were given weekly at a dose of 50 μg plasmid per animal. Initiate treatment after recovery from the onset acute episode of EAE (eg, after recovery from the first clini...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 