Method for inserting target DNA fragment into vector

A purpose and fragment technology, applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, etc., can solve the problems of lack of flexibility, high price, harsh conditions, etc., and achieve the effect of wide application range, low cost and simple operation

Inactive Publication Date: 2010-12-01
JIERUI BIOENG SHANGHAI
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these cloning methods are expensive, and there are limitations in the number of bases recognized by recombinases. The number of homologous complementary bases that undergo recombination must be 15 bases, the conditions are harsh, lack of flexibility, and there is no effect of excision

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inserting target DNA fragment into vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] 1) Preparation of insert fragments

[0021] The sequences of the PCR primers are as follows:

[0022] Forward primer: TGCCGCGCGGCAGCC ATGAGCCATATTCAACGG;

[0023] Reverse primer: GTTAGCAGCCGGATC GAAAAACTCATCGAGCATCAAATG.

[0024] The underlined part is the exo-recombination homologous vector sequence, and the rest is the template sequence. Primers were synthesized by Shanghai Jierui Bioengineering Co., Ltd.

[0025] Using the plasmid pET28a (purchased from Novagen) as a template, the PCR reaction was carried out using the above primers. The PCR reaction was carried out using a PCR amplification kit from Shanghai Jierui Bioengineering Co., Ltd. The PCR reaction system and reaction procedure are as follows.

[0026] PCR amplification system:

[0027] template DNA

1μl

10×PCR buffer

1.5μl

MgCl 2 (25nM)

1.5μl

dNTP (10mM)

0.3μl

Forward primer (10pM)

0.25μl

Reverse primer (10pM)

0.25μl

Taq e...

Embodiment 2

[0050] 1) Preparation of insert fragments

[0051] The sequences of the PCR primers are as follows:

[0052] Forward primer: CCTGGTGCCGCGCGGCAGCC ATGAGCCATATTCAACGG;

[0053] Reverse primer: GCTTTGTTAGCAGCCGGATC GAAAAACTCATCGAGCATCAAATG.

[0054] 2) The preparation of the linear carrier is the same as in Example 1.

[0055] 3) The establishment of the homologous recombination reaction system is the same as in Example 1.

[0056] 4) conversion, with embodiment 1.

[0057] 5) Determination of recombinant identification and acquisition rate of effective clones

[0058] The number of clones on the petri dish was 136, and 16 single colonies were randomly selected for sequencing. The results showed that 15 were positive clones containing the target fragment, and 1 was empty vector.

Embodiment 3

[0060] 1) Preparation of insert fragments

[0061] The sequences of the PCR primers are as follows:

[0062] Forward primer: CAGCC ATGAGCCATATTCAACGG;

[0063] Reverse primer: GGATC CGAAAAAACTCATCGAGCATCAAAATG.

[0064] 2) The preparation of the linear carrier is the same as in Example 1.

[0065] 3) The establishment of the homologous recombination reaction system is the same as in Example 1.

[0066] 4) conversion, with embodiment 1.

[0067] 5) Determination of recombinant identification and acquisition rate of effective clones

[0068] The number of clones on the petri dish was 63, and 16 single colonies were randomly selected for sequencing. The results showed that 13 were positive clones containing the target fragment, and 3 were empty vectors.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for inserting a target DNA fragment into a vector. The method comprises the following steps of: 1) designing and synthesizing a primer for amplifying the target DNA fragment and amplifying by using the primer to obtain the target DNA fragment, wherein 3 to 20 bases on the outmost side of the primer are completely complementary with the outmost side of a linear vector; and 2) mixing the target DNA fragment and the linear vector, and adding a recombinant enzyme with the excision enzyme activity and the homologous recombination enzyme activity from ends 3' to 5' for reaction to obtain a recombinant vector into which the target DNA fragment is inserted. The method has the advantages of dual effects of excision and homologous recombination, more flexible selection for the number of bases at the recombinant ends by selecting the number of homologous bases of a PCR product and the linear vector in a wider range (namely 3 to 20 bases), no need of DNA ligase, linearization for the target vector only, no need of enzymatic treatment on the PCR product, direct mixing with a target vector, one-stop solution for all the problems within 20min, realization of perfect seamless connection, simple operation and low cost.

Description

technical field [0001] The invention belongs to the field of bioengineering, in particular to a method for inserting target DNA fragments into vectors. Background technique [0002] In order to quickly and directionally insert the target gene fragment into the designated vector, the conventional operation mode is to obtain the target fragment by polymerase chain reaction, and then T / A clone it into the T vector, after ligation, transformation, screening, and sequencing steps verification, and then The target gene is excised by double enzyme digestion, then ligated with the linearized designated vector, and then repeated ligation, transformation, screening, sequencing steps, and finally the target clone is obtained. The disadvantages are as follows: [0003] 1) The design of amplification primers for polymerase chain reaction requires the introduction of enzyme cleavage sites and protective bases. If the protective bases are not selected properly, the methylation of the flan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/66
Inventor肖爱军邵标赫英俊
OwnerJIERUI BIOENG SHANGHAI