Supercharge Your Innovation With Domain-Expert AI Agents!

Canine parvovirus LAMP detection kit and detection method thereof

A detection kit and canine parvovirus technology, applied in the field of biochemical detection, can solve the problems of easy cross-contamination operation process, increase the difficulty of popularization and application, and unsuitable rapid inspection, so as to reduce pollution, convenient and intuitive result identification, and easy to use on a large scale Promoted app performance

Inactive Publication Date: 2012-08-22
SHANGHAI JIAOTONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Found through literature retrieval to prior art, Desario, C etc. published " Canine parvovirus infection: which diagnostic test for virus " in " Journal of Virological Methods " (viral methodology) 2005, the 126th period, 179~185 pages ? "(What are the methods for detecting canine parvovirus) article, commented in the article, the detection methods of canine parvovirus mainly include polymerase chain reaction (PCR), virus isolation (VI), enzyme-linked immunosorbent assay (ELISA), etc.; but these The technology requires special instruments, and has the disadvantages of easy cross-contamination and cumbersome operation process, so it is not suitable for rapid on-site inspection. At the same time, due to the high cost of detection, it also increases the difficulty of popularization and application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Canine parvovirus LAMP detection kit and detection method thereof
  • Canine parvovirus LAMP detection kit and detection method thereof
  • Canine parvovirus LAMP detection kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] LAMP Detection of Canine Parvovirus

[0030] Step 1, design of LAMP primers

[0031] (1) Retrieve the genome sequence of canine parvovirus from the gene database, and perform sequence comparison by DNAstar software to obtain the specific conserved sequence of canine parvovirus genome SEQ ID NO: 7;

[0032] (2) LAMP primer design was performed on the conserved sequence by LAMP primer design software (Primer Explorer software, version 4.0), and 6 primers were obtained:

[0033] The sequence of primer F3 is shown in SEQ ID NO: 1;

[0034] The sequence of primer B3 is shown in SEQ ID NO: 2;

[0035] The sequence of primer FIP is shown in SEQ ID NO: 3;

[0036] The sequence of primer BIP is shown in SEQ ID NO: 4;

[0037] The sequence of primer LF is shown in SEQ ID NO: 5;

[0038] The sequence of primer LB is shown in SEQ ID NO: 6;

[0039] Step 2, optimization of the LAMP reaction system

[0040] Optimization of the LAMP reaction system by Mg 2+ concentration, reac...

Embodiment 2

[0058] Sensitivity analysis of LAMP detection system

[0059] Use a spectrophotometer to measure the OD260nm value of the parvovirus nucleic acid extracted from dog feces, and put the value into the formula to calculate its concentration. Then it was diluted 10 times, and each concentration after dilution was 5.7×10 7 copies / μL, 5.7×10 6 copies / μL...5.7×10 0 copies / μL, use it as a template

[0060] The LAMP method and the ordinary PCR method were detected, and the sensitivity of the two methods was compared. The reaction system of the LAMP method is the best reaction system and the best reaction time and temperature in Example 1.

[0061] Common PCR method reaction system is:

[0062] 2×PCR TaqMix (Tiangen Biochemical Technology (Beijing) Co., Ltd.) 25 μL,

[0063] Primer 1 (50 μmol / L) 0.5 μL

[0064] The primer 1 is: 5'TCTGCTACTCAGCCACCAA 3' (SEQ ID NO: 8)

[0065] Primer 2 (50μmol / L) 0.5μL

[0066] The primer 2 is: 5'ACCTCCTTCAGCTTGAGGCAA 3' (SEQ ID NO: 9)

[0067]...

Embodiment 3

[0074] Specificity Analysis of LAMP Detection System

[0075] In order to verify the specificity of the LAMP detection system, Trizol commercial RNA extraction kit was used to extract the nucleic acids of viruses that may have potential cross-reactions, and the nucleic acids of canine parvovirus, canine distemper virus, porcine parvovirus and human parvovirus B19 LAMP-specific detection for the template,

[0076] The reaction system is a 25uL system containing 10×Thermopol buffer (NEB, USA) 2.5uL, 50uM primer FIP 0.8uL, 50uM primer BIP 0.8uL, 50uM primer F30.1uL, 50uM primer B30.1uL, 50uM primer LF 0.4uL, 50uM primer LF 0.4uL, 2.5mM dNTP mix 8uL, 5Mbetaine (Sigma, USA) 5uL, 1M MgSO40.2uL, 8U / uL BstDNase (NEB, USA) 1uL, ultrapure water 2.7uL; template DNA 3uL; reaction conditions: constant temperature at 63°C 60min.

[0077] The results showed that the LAMP detection system had good specificity and could not detect other non-target viral nucleic acids. Such as figure 2 as ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a canine parvovirus LAMP detection kit and a detection method thereof in the technical field of health inspection. The kit comprises six primers the base sequences of which are respectively shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6. The detection method by adopting the kit has the following steps: step one, extracting nucleic acid of a sample to be detected by a conventional method; and step two, adopting the LAMP detection kit to detect the nucleic acid in the sample, and judging whether canine parvovirus exists in the sample. The kit in the invention has simple use, intuitive result and high specificity and sensitivity.

Description

technical field [0001] The invention relates to a kit and a detection method in the technical field of biochemical detection, in particular to a LAMP (loop-mediated isothermal amplification) detection kit for canine parvovirus and a detection method thereof. Background technique [0002] Canine parvovirus (Canine parvovirus, CPV) belongs to Parvoviridae, Parvovirus genus, feline parvovirus subgroup (Parvovirinae). CPV is an important pathogen for dogs and canine animals. It can cause acute enteritis, leukopenia, severe vomiting, and myocarditis in puppies. This disease all can take place all the year round, with sudden onset, short course of disease, strong infectivity, high mortality rate, often in explosive fashion. Dogs of different ages, genders, and breeds can be infected, and its untreated survival rate is less than 5%. It is one of the most serious infectious diseases that endanger the dog industry in my country. The current detection method is generally to first sa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68G01N21/78
Inventor 华修国崔立郭伟商晓桂单同领
Owner SHANGHAI JIAOTONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More