Canine parvovirus LAMP detection kit and detection method thereof
A canine parvovirus and detection kit technology, applied in the field of biochemical detection, can solve the problems of easy cross-contamination operation process, increase the difficulty of popularization and application, uncomfortable and rapid inspection, etc., and achieves reduction of pollution, convenient and intuitive result identification, and easy large-scale detection. The effect of promoting the application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] LAMP Detection of Canine Parvovirus
[0030] Step 1, design of LAMP primers
[0031] (1) The genome sequence of canine parvovirus was retrieved from the gene database, and sequence comparison was performed by DNAstar software to obtain the specific conserved sequence SEQ ID NO: 7 of the canine parvovirus genome;
[0032] (2) LAMP primer design was performed on the conserved sequence by LAMP primer design software (Primer Explorer software, version 4.0), and 6 primers were obtained:
[0033] The sequence of primer F3 is shown in SEQ ID NO: 1;
[0034] The sequence of primer B3 is shown in SEQ ID NO: 2;
[0035] The sequence of primer FIP is shown in SEQ ID NO: 3;
[0036] The sequence of primer BIP is shown in SEQ ID NO: 4;
[0037] The sequence of primer LF is shown in SEQ ID NO: 5;
[0038] The sequence of primer LB is shown in SEQ ID NO: 6;
[0039] Step 2, optimization of the LAMP reaction system
[0040] Optimization of the LAMP reaction system by Mg 2+ conc...
Embodiment 2
[0058] Sensitivity analysis of LAMP detection system
[0059] Use a spectrophotometer to measure the OD260nm value of the parvovirus nucleic acid extracted from dog feces, and put the value into the formula to calculate its concentration. Then it was diluted 10 times, and each concentration after dilution was 5.7×10 7 copies / μL, 5.7×10 6 copies / μL...5.7×10 0 copies / μL, use it as a template
[0060] The LAMP method and the ordinary PCR method were detected, and the sensitivity of the two methods was compared. The reaction system of the LAMP method is the best reaction system and the best reaction time and temperature in Example 1.
[0061] Common PCR method reaction system is:
[0062] 2×PCR TaqMix (Tiangen Biochemical Technology (Beijing) Co., Ltd.) 25 μL,
[0063] Primer 1 (50 μmol / L) 0.5 μL
[0064] The primer 1 is: 5'TCTGCTACTCAGCCACCAA 3' (SEQ ID NO: 8)
[0065] Primer 2 (50μmol / L) 0.5μL
[0066] The primer 2 is: 5'ACCTCCTTCAGCTTGAGGCAA 3' (SEQ ID NO: 9)
[0067]...
Embodiment 3
[0074] Specificity Analysis of LAMP Detection System
[0075] In order to verify the specificity of the LAMP detection system, Trizol commercial RNA extraction kit was used to extract the nucleic acids of viruses that may have potential cross-reactions, and the nucleic acids of canine parvovirus, canine distemper virus, porcine parvovirus and human parvovirus B19 LAMP-specific detection for the template,
[0076] The reaction system is a 25uL system containing 10×Thermopol buffer (NEB, USA) 2.5uL, 50uM primer FIP 0.8uL, 50uM primer BIP 0.8uL, 50uM primer F30.1uL, 50uM primer B30.1uL, 50uM primer LF 0.4uL, 50uM primer LF 0.4uL, 2.5mM dNTP mix 8uL, 5Mbetaine (Sigma, USA) 5uL, 1M MgSO40.2uL, 8U / uL BstDNase (NEB, USA) 1uL, ultrapure water 2.7uL; template DNA 3uL; reaction conditions: constant temperature at 63°C 60min.
[0077] The results showed that the LAMP detection system had good specificity and could not detect other non-target viral nucleic acids. Such as figure 2 as ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 