Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof

A molecular marker and wheat technology, applied in the field of wheat breeding and molecular biology, can solve the problem that there is no report on the main QTL molecular marker for resistance to wheat yellow mosaic disease, and achieve the goal of improving breeding efficiency, reducing workload and accelerating selection progress. Effect

Inactive Publication Date: 2011-01-05
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] So far, there is no report of molecular markers linked to CI12633 major QTL for resistance to wheat yellow mosaic disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof
  • Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof
  • Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Determination of the resistance source CI12633 of wheat yellow mosaic disease

[0018] 1. Extract the DNA of wheat variety CI12633

[0019] The leaves of the plant of the wheat variety CI12633 were isolated and extracted the DNA obtained by the CTAB extraction method.

[0020] 2. Detect the DNA of wheat variety CI12633, and screen out the molecular markers closely linked to the main QTL for wheat yellow mosaic disease resistance:

[0021] PCR primer Wmc327:

[0022] Upstream primer: 5’TGCGGTACAGGCAAGGCT 3’;

[0023] Downstream primer: 5'TAGAACGCCCTCGTCGGA 3'.

[0024] PCR primer Gwm154:

[0025] Upstream primer: 5’TCACAGAGAGAGAGGGAGGG 3’;

[0026] Downstream primer: 4: 5'ATGTGTACATGTTGCCTGCA 3'.

[0027] PCR amplification:

[0028] The PCR primer Wmc327 was used to amplify the DNA of the obtained wheat variety CI12633 plant. After the amplified product was separated by electrophoresis on a 12% polyacrylamide gel, a molecular marker Xwmc327-180 with a size of 180 bp was obtained.

[0029...

Embodiment 2

[0033] The molecular markers Xwmc327-180 and Xgwm154-105 with sizes of 180bp and 105bp were used to predict the resistance of wheat yellow mosaic disease to the derivative lines of wheat variety CI12633:

[0034] Identification object:

[0035] The wheat cultivar CI12633 was crossed with Yangmai 158 and bred to the offspring of F8 generation. The different line numbers were defined as: E294, E304, E310, E313, E316, E322, E332, E351, E367, E386. All of them were used as identification targets with unknown resistance to wheat yellow mosaic disease.

[0036] The wheat varieties CI12633 and Yangmai 158 with known resistance to wheat yellow mosaic disease were used as reference identification objects.

[0037] Identification process

[0038] a) Use molecular markers closely linked to the main QTL for wheat yellow mosaic disease resistance for identification

[0039] First, extract the DNA obtained from the leaves of each identified object using the CTAB extraction method, and then use the mo...

Embodiment 3

[0052] The molecular markers Xwmc327-180 and Xgwm154-105 with sizes of 180bp and 105bp were used to predict the resistance of wheat yellow mosaic disease to the derivative lines of wheat variety CI12633:

[0053] Identification object:

[0054] Use wheat variety CI12633 and Yangmai 158 to cross, and bred to F 8 The different strain numbers of the offspring of this generation are defined as: E303, E305, E327, E343, E362, E397, E330, E355, E376, E379. All of them were used as identification targets with unknown resistance to wheat yellow mosaic disease.

[0055] The wheat varieties CI12633 and Yangmai 158 with known resistance to wheat yellow mosaic disease were used as reference identification objects.

[0056] The identification process is completely the same as in Example 2, and will not be repeated, and their results are also summarized and recorded in Table 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular marker tightly linked with a wheat yellow mosaic resistant major quantitative trait locus (QTL). The molecular marker is characterized in that: polymerase chain reaction (PCR) amplification is performed on deoxyribonucleic acid (DNA) of a wheat variety CI12633 by using PCR primers, namely, Wmc327 and Gwm154; an amplification product is subjected to electrophoretic separation on 12 percent polyacrylamide gel so as to obtain molecular markers, namely, Xwmc327-180 and Xgwm154-105 tightly linked with the wheat yellow mosaic resistant major QTL; the sizes of the Xwmc327-180 and the Xgwm154-105 are 180bp and 105bp respectively; and the molecular markers are used for detecting the genotype of a derivative variety or strain of the wheat variety CI12633 so as to judge whether the derivative variety or strain can resist wheat yellow mosaic or not.

Description

Technical field [0001] The invention relates to a molecular marker closely linked to the main QTL for wheat yellow mosaic disease resistance and its application, and belongs to the field of wheat breeding and molecular biology. Background technique [0002] Wheat yellow mosaic disease is a soil-borne virus disease caused by wheat yellow mosaic virus (WYMV) with fungus as a vector. Sawada (1927) in Japan first discovered and described wheat yellow mosaic disease. Inouye (1969) proved that the pathogen of the disease is wheat yellow mosaic virus (WYMV). Because the symptoms of wheat yellow mosaic virus are similar to those of wheat spindle streak mosaic virus (WSSMV) first discovered on winter wheat in Ontario, Canada (Slykui, 1960), both names have been used in my country. And European isolates, and later genomic studies of isolates in different regions confirmed that the North American and European isolates were WSSMV, while the Asian isolates were WYMV (Lei, 1998; Chen, 2000). ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor任丽娟周淼平杨学明姚金保马鸿翔
OwnerJIANGSU ACADEMY OF AGRICULTURAL SCIENCES