Check patentability & draft patents in minutes with Patsnap Eureka AI!

L27e family protein antigen epitope, antibody and application thereof

A protein antigen and antigen epitope technology, applied in the fields of molecular biology and immunology, can solve the problems of high error probability of antigenic determinants and specificity problems, and achieve the effect of good specificity and high serum titer.

Active Publication Date: 2012-10-10
BGI SHENZHEN CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The epitopes used can be predicted by software, but some studies have shown that the error probability of software predicting epitopes is high (Chang HT, Liu CH, Pai TW. Estimation and extraction of B-cell linear epitopes predicted by mathematical morphology approaches. J Mol Recognit .2008 Nov-Dec; 21(6):431-41), and the software has specificity problems in the prediction of epitopes of full-length antigens, and experimental verification is needed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • L27e family protein antigen epitope, antibody and application thereof
  • L27e family protein antigen epitope, antibody and application thereof
  • L27e family protein antigen epitope, antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Selection and synthesis of a rice 60S ribosomal protein L27e family protein epitope

[0042] The gene number of the gene corresponding to the rice 60S ribosomal protein L27e family protein is 0s10g0564300 in NCBI. This gene is located on rice chromosome 10, and its cDNA sequence is as follows:

[0043] ATGGTGAAGTTTCTCAAGCCCGGGAAGGCGGTGATCCTGCTGCAGGGGAGGTTCGCGGGGCGGAAGGCGGTGATCGTGCGGGTGTTCGAGGAGGGCACCCGCGACCGCCCCTACGGCCACTGCCTCGTCGCCGGCCTCGCCAAGTACCCCAAGAAGGTGATCCGCAAGGACTCGGCGAAGAAGACGGCGAAGAAGTCGCGCGTCAAGTGCTTCCTCAAGCTCGTCAACTTCACCCACCTCATGCCCACCCGCTACACCCTCGACGTCGACCTCAAGGAGGTCGCCGCGGGGCCCGACGCGCTCGCCACCAGGGACAAGAAGGTCGCCGCCTGCAAGTCCGCCAAGGCGCGCCTCGAGGACCGCTTCAAGACCGGCAAGAACAGGTGGTTCTTCACCAAGCTCCGCTTCTGA(SEQ ID NO:1)。

[0044] The encoded amino acid sequence is as follows:

[0045] MVKFLKPGKA VILLQGRFAG RKAVIVRVFE EGTRDRPYGH CLVAGLAKYPKKVIRKDSAK KTAKKSRVKC FLKLVNFTHL MPTRYTLDVD LKEVAAGPDALATRDKKVAA CKSAKARLED RFKTGKNRWF FTKLRF (SEQ ID NO: 2).

[0046] 1) Us...

Embodiment 2

[0051] Example 2 Preparation of Rice L27e Family Protein Polyclonal Antibody

[0052] 1) Preparation of multiple antiserum against rice L27e family proteins

[0053] Take 1-2 mg of the antigenic epitope-KLH complex prepared in Example 1 and fully emulsify it with an equivalent amount of complete Freund's adjuvant to form water-in-oil, and subcutaneously multiply it on the neck and back of New Zealand white rabbits at 6-8 weeks. Point injection, about 100μg per point. Booster immunization 2 weeks later, the dose is the same as before, fully emulsified with incomplete Freund's adjuvant, and inject multiple points subcutaneously on the back of the rabbit; after that, boost immunization once every 2 weeks; immune) control. From the second booster immunization, 7 days after each immunization, blood was taken from the ear vein to measure the titer of the antibody. After 4 booster immunizations, the immune titer of the epitope-KLH complex was 1:25600, and the naked peptide The imm...

Embodiment 3

[0058] Example 3 Expression Analysis of Rice L27e Family Proteins at Different Developmental Stages

[0059] Select paddy rice 93-11 aboveground part at seedling stage, blade at tillering stage, flag leaf at booting stage, flag leaf at flowering stage, flag leaf at mature stage, underground part at seedling stage, stem at tillering stage, ear at flowering stage, ear at mature stage (9 parts in total ) and other tissues of different developmental stages and different parts, the total protein was extracted, and the total protein content of each sample was determined by the Bradford method.

[0060] Among them, the method of extracting the total protein is as follows: use liquid nitrogen to grind fresh rice (variety: 93-11, obtained from the National Hybrid Rice Engineering Technology Center) from various parts of the tissue to powder, and pack it into pre-cooled centrifuge tubes, and every 300 μl of powder Add 800 μl of protein lysate, mix quickly and place on ice, incubate in t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an L27e family protein antigen epitope or variants thereof, and a composition containing the antigen epitope or variants thereof. The L27e family protein antigen epitope is composed of an amino acid sequence showed by SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5. The invention also relates to a polyclonal antibody for resisting the L27e family protein and a preparation method thereof. The invention also relates to a method of detecting the L27e family protein with the polyclonal antibody and application of the polyclonal antibody.

Description

technical field [0001] The invention belongs to molecular biology and immunology, and specifically relates to a ribosomal protein, especially an antigenic epitope of a 60S ribosomal protein L27e family protein, an antibody thereof and use thereof. Background technique [0002] Ribosome is an important organelle in all living cells (except mature mammalian blood cells), mainly composed of RNA and protein (ribosomal RNA is called rRNA, and protein is called r protein). In eukaryotic cells (except for mitochondria and chloroplast ribosomes), ribosomes are 80S, with a relative molecular weight of 4800×10 3 , composed of 60S large subunit and 40S small subunit. The large subunit is composed of 28SrRNA, 5.8SrRNA, 5SrRNA and 49 r-proteins, while the small subunit is composed of 18SrRNA and 33 r-proteins. Ribosomes efficiently and precisely synthesize polypeptide chains from amino acids in accordance with the instructions of mRNA. [0003] More and more evidences show that beside...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K7/08
Inventor 刘国振兰金苹李晓明李启沅周宝津
Owner BGI SHENZHEN CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com