Preparation method of antibacterial peptide cecropin feed additive

A technology of feed additive and peptide cecropin, which is applied in the field of genetic engineering, can solve problems such as methanol poisoning, and achieve the effects of simplifying the production process, reducing costs and simplifying operations

Inactive Publication Date: 2011-06-15
SHANDONG UNIV
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression of heterologous proteins in Pichia pastoris needs to be induced by methanol, and the residual methanol may cause toxic effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of antibacterial peptide cecropin feed additive
  • Preparation method of antibacterial peptide cecropin feed additive
  • Preparation method of antibacterial peptide cecropin feed additive

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Acquisition of antimicrobial peptide cecropin gene:

[0032] There is a large difference in codon preference between Saccharomyces cerevisiae and Drosophila. In order to enable the Drosophila antimicrobial peptide cecropin gene to be expressed more efficiently in S. The amino acid sequence of the Drosophila antimicrobial peptide cecropinA1 is converted into a nucleic acid sequence suitable for expression in Saccharomyces cerevisiae. At the same time, issues such as GC content and secondary structure of the entire nucleic acid sequence must be considered to avoid premature termination of the translation process. For the comparison of the CecropinA1 mRNA sequence with the CecropinA1 artificially synthesized sequence designed according to its amino acid sequence, see figure 1 .

[0033] After introducing the two ends of the Cecropin A1 nucleic acid sequence (cecA1) with the designed sequence as shown in SEQ ID NO.14 into the Not I restriction site, it was handed over to J...

Embodiment 2

[0035] Construction of multi-copy integrated expression vector

[0036] (1) Construction of carrier backbone pYB-1:

[0037] (i) Amplification of the Bgl fragment: Using YIPlac204 as a template and primers b1 and b2 as primers, the Bgl fragment was amplified by PCR technology and Aat II, EcoR I and Bgl II restriction sites were introduced at both ends of it. The primer sequences are as follows: the underlined part is the recognition site of Bgl II, the shaded part is the recognition site of Aat II, and the sequence in the frame is the recognition site of EcoR I.

[0038] Primer b1: 5' AGATCT ATTCTTGCCACGACTCATCTCC 3'; (SEQ ID NO. 2)

[0039] Primer b2: 5' AGATCT GATTCCGATGCTGACTTGCTG 3'; (SEQ ID NO. 3)

[0040] The PCR reaction conditions were 94° C. for 2 min, 94° C. for 30 sec, 60° C. for 30 sec, and 72° C. for 30 sec. The cycle was repeated 34 times, and 72° C. for 10 min. A DNA fragment of 280 bp was obtained by PCR. After the fragment was purified and recovered, ...

Embodiment 3

[0070] The preparation method of the antibacterial peptide cecropin feed additive, the steps are as follows:

[0071] (1) Construction of cecA1 expression vector: pUC57-cecA1 and carrier pYIP-6 prepared in Example 1 were digested with Not I, and the corresponding fragments were recovered by gel cutting for connection, and the connection liquid was transformed into E.coli TOP10 strain, and coated LB (100 μg / mL ampicillin) plates.

[0072] Pick a number of transformants, shake the bacteria overnight, and use the bacterial liquid as a template to perform bacterial liquid PCR. The primer sequences are as follows:

[0073] P1: CAGATCATCAAGGAAGTA, SEQ ID NO. 15

[0074] P2: CCTTACCTTCCAATAATTCC SEQ ID NO. 16

[0075] The reaction conditions were: 95°C for 2 min; 94°C for 30 sec, 54°C for 30 sec, 72°C for 30 sec, and the cycle was repeated 34 times; 72°C for 10 min.

[0076] Get about 323bp size fragment ( figure 2 ), that is, cecA1 of 203bp plus a distance of about 120bp betwee...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a preparation method of an antibacterial peptide cecropin feed additive, belonging to the technical field of gene engineering. The preparation method of the antibacterial peptide cecropin feed additive comprises the following steps of: (1) carrying out enzyme cutting to an antibacterial peptide cecropin gene and a multicopy integration expression vector respectively by Not I, after connecting by DNA ligase, converting E.coli TOP10 bacterial strains, coating an LB (Luria-Bertani) flat plate, carrying out enzyme cutting verification by the Not I, and selecting and naming a transformant inversely inserted into a cecA1 fragment as pYIP-cecA1; (2) carrying out enzyme cutting to the pYIP-cecA1 prepared in step (1) by using Hpa I, recovering big fragments, adding the pYIP-cecA1 into 80 muL of yeast electricity transformation competent cells, carrying out electric shock on a mixture, and screening the mixture by the YEPD (Yeast Extract Peptone Dex) flat plate of G418 to obtain the yeast cell for expressing the cecropin; and (3) culturing the yeast cell for expressing the cecropin, which is prepared in step (2), and drying to obtain the cecropin feed additive. According to the preparation method, the production cost of the cecropin can be lowered, and a good foundation is laid for popularizing the cecropin to serve as the feed additive to be antibiotics substitute for feeds.

Description

technical field [0001] The invention relates to a preparation method of an antibacterial peptide cecropin feed additive, belonging to the technical field of genetic engineering. Background technique [0002] Livestock and poultry and aquaculture occupy an important position in the national economy. While high-density breeding methods increase production, they also lead to the breeding of biological diseases and cause huge economic losses. At present, antibiotics are commonly used to prevent and control diseases, but the resulting problems such as drug residues and pathogenic bacteria resistance endanger human health and the environment, and become an important reason for restricting the export of livestock and aquatic products. Today, as people pay more and more attention to food safety, finding safe and efficient alternatives to antibiotics and developing healthy farming have become important research directions in feed science. At present, antibiotic substitutes mainly a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12P21/02C12N15/09C12N1/19A23K1/16C12R1/85A23K10/16A23K20/147
Inventor 张燕君孙冰玉刘增英
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap