Laodelphax striatellus lethal gene fragment ADP-ribosylation factor based on gene-silencing technology and dsRNA thereof

A gene fragment and technology of SBPH, applied in the field of agricultural biology, can solve problems such as environmental pollution and poor control effect of chemicals, and achieve the effect of facilitating experimental operation, facilitating large-scale experiments or commercial use, and reducing mechanical damage

Inactive Publication Date: 2011-10-19
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Laodelphax striatellus lethal gene fragment ADP-ribosylation factor based on gene-silencing technology and dsRNA thereof
  • Laodelphax striatellus lethal gene fragment ADP-ribosylation factor based on gene-silencing technology and dsRNA thereof
  • Laodelphax striatellus lethal gene fragment ADP-ribosylation factor based on gene-silencing technology and dsRNA thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Cloning method of ADP-ribosylation factor gene fragment:

[0040] (1) Get 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;

[0041] (2) Synthesizing the first strand of cDNA;

[0042] (3) Obtain the gene fragment sequence from the SBPH transcriptome, and after homology comparison at http: / / www.ncbi.nlm.nih.gov / , it is predicted to be the ADP-ribosylation factor gene of SBPH, using Primer premier 5.0 software designed P1 and P2, amplified by RT-PCR method;

[0043] Upstream primer (P1): 5'TGAAGGCAGTCAGGAAA 3' (SEQ ID NO.2),

[0044] Downstream primer (P2): 5'TAGGCTTATTATCACCACAAC 3' (SEQ ID NO.3);

[0045] PCR conditions are: denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 55°C, 30sec at 72°C, 35 cycles, extension at 72°C

[0046] PCR reaction system (50μL):

[0047]

[0048]

[0049] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;

[0050] (5) Insert the recovered target f...

Embodiment 2

[0054] Embodiment 2.dsRNA synthesis and recovery

[0055] (1) According to the verified ADP-ribosylation factor gene fragment sequence, use Primer Premier 5.0 software to design P3 and P4, and add the T7 promoter sequence TAATACGACTCACTATAGGG at the 5' end of the upstream and downstream primers;

[0056] Upstream primer (P4): 5'TAATACGACTCACTATAGGGTGAAGGCAGTCAGGAAA 3'(SEQ ID NO.5)

[0057] Upstream primer (P5): 5'TAATACGACTCACTATAGGGTAGGCTTATTATCACCACAAC 3'(SEQ ID NO.6)

[0058]

[0059] PCR conditions: Denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.

[0060] (2) The PCR product was separated by electrophoresis on a low-melting point agarose gel with a concentration of 1% and observed under ultraviolet light. The results are shown in figure 1 , whose sequence is shown in SEQ ID NO.4.

[0061] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:

[0062] ① Cut the gel of the separated target frag...

Embodiment 3

[0072] Embodiment 3.dsRNA feeding experiment

[0073] (1) Seal one end of the glass tube with a parafilm, suck the second-instar SBPH into the glass tube with a sucker, and seal the other end with gauze;

[0074] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, put the prepared parafilm sticker up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;

[0075] (3) Draw 100 μl of feed with a pipette gun and drop it in the center of the parafilm, the control only adds feed (recipe is shown in Table 1), and the treatment group adds dsRNA of ADP-ribosylation factor gene in the feed, the concentration of dsRNA is 4337ng / μl, Use a new parafilm, with the sticker side facing down, on the opening of the glass tube, and seal the feed and dsRNA between the two layers of parafilm;

[0076] (4) Put the glass tube with feed and dsRNA back on the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Belonging to the field of agricultural biotechnology, the invention relates to a laodelphax striatellus lethal gene fragment ADP-ribosylation factor based on gene-silencing technology and dsRNA thereof. By a laboratory improved dsRNA feeding method, the invention, from laodelphax striatellus, screens out the laodelphax striatellus lethal gene fragment ADP-ribosylation factor which can lead to laodelphax striatellus death and has sequences as shown in SEQ ID No.1. Feeding laodelphax striatellus with the dsRNA of the gene fragment provided in the invention can have good lethal effect, thus providing sequence and data bases for establishing new strategies of pest control with RNA interference technology.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to a lethal gene fragment ADP-ribosylation factor and dsRNA thereof based on gene silencing technology. Background technique [0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle. In addition, the rice stripe leaf blight caused by the stripe virus transmitted by the striatellus striatellus is poorly controlled by pesticides after the onset, so we can only rely on pest control to prevent disease. Therefore, in the practice of agricultural production, there is an urgent need for alternative control methods other than chemical pesticides. [0003] RNA interference (RNA interference, RNAi) is a gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C12N15/113C12N15/10A01K67/033
Inventor 李飞李国清董双林韩召军姜卫华
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap