Mice transplanted with human hepatocytes
A liver cell and mouse technology, applied in the field of mice transplanted with human liver cells, can solve the problems of human liver cell damage and adenovirus without species specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0178] Preparation of TK-NOG mice and analysis of their functions
[0179] 1. Method
[0180] This example was carried out by the following method.
[0181] (1) Preparation of transgenic mice
[0182] Such as figure 1As shown, a herpes simplex virus type 1 thymidine kinase (UL23 or HSVtk) gene expression unit was constructed. First, a 42-nucleotide polylinker (GATCCAAGCTTATGCAGTCGACCCGGGCATGCGAATTCTCGA: SEQ ID NO: 2) was introduced into the Bam HI-Xho I site (pBSII / linker) of pBlueScriptII (pBSII; Promega). The HSVtk gene was amplified by PCR at an annealing temperature of 62°C using the following primers.
[0183] HTKF, 5'-GCTAGCATGGCTTCGTACCCCCTGC-3' (SEQ ID NO: 3)
[0184] HTKR, 5'-GTCGACTCAGTTAGCCTCCCCCCATCTC-3' (SEQ ID NO. 4)
[0185] Next, the amplified product was cloned into the Nhe I-Sal I site (pCI-TK) of pCI plasmid (Promega). The 3' flanking region of human growth hormone (hGH) was amplified by PCR using the following primers at an annealing temperature of 6...
Embodiment 2
[0256] Example 2 Preparation of uPA-NOG mice and its functional analysis
[0257] 1. Method
[0258] This example was carried out by the following method.
[0259] (1) Preparation of transgenic mice
[0260] Such as Figure 25 The mouse urokinase-type plasminogen activator factor (Plau or uPA) gene expression unit was constructed as shown. First, the mouse uPA gene was amplified by PCR using the following primers at an annealing temperature of 60°C.
[0261] MuPA-Nhe1-F, 5'-GCTAGCGGCACTACCATGAAAGTC-3' (SEQ ID NO: 48) MuPA-Sal1-R, 5'-AATTAAGTCGACAACAAGTGACCC-3' (SEQ ID NO: 49)
[0262]The herpes simplex virus type 1 thymidine kinase gene expression plasmid (pmAlbEPintUL23GH) described in Example 1 was double-digested with the restriction enzyme Nhe I Sal I to remove the herpes simplex virus type 1 thymidine kinase gene portion, and then, in The above-mentioned mouse uPA gene (SEQ ID NO: 47) treated with the enzyme was cloned at the corresponding site to obtain a plasmid (p...
Embodiment 3
[0292] Example 3 Evaluation of the Dynamics of Drugs in Plasma, Identification of Metabolites, Metabolism Rates, etc.
[0293] 1. Metabolism test of isoquine (DB) or S-warfarin (WF) in mouse organisms with humanized liver
[0294] For chimeric mice (hu-Liver: human albumin concentration in the blood is 4.5 mg / mL or higher) whose liver has been replaced by human hepatocytes for more than 50%, DB (Research Biochemicals International), or WF (Wako Pure Chemical Industries, Ltd.) was intraperitoneally administered at a volume of 30 mg / kg. Blood samples with a volume of 40 μl were recovered by orbital blood sampling 0, 0.5, 1, 2, 4, 7, and 24 hours after administration of DB or WF, and plasma was separated from the blood by centrifugation.
[0295] 2. Quantification of DB, 4-hydroxyl DB (4-OH DB), WF and 7-hydroxyl WF (7-OH WF) by LC-MS / MS
[0296] The concentrations of DB and 4-OH DB in plasma were determined by the following method. 150 μL of distilled water was added to 5 μL ...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com