Pesticide Bt protein Cry8Pa1 and coding gene and use thereof
A technology that encodes genes and bt proteins, applied in applications, insecticides, genetic engineering, etc., to achieve the effects of reducing costs, improving insect resistance, and good insecticidal activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Cloning of Cry8Pa1 gene
[0032] The new bacterial strain ST8 of Bacillus thuringiensis isolated from the soil in the plain area of Chengdu, Sichuan Province in the present invention has been obtained in the General Microorganism Center of China Microbiological Culture Collection Management Committee (Address: West Beichen, Chaoyang District, Beijing) on June 12, 2010. Road No. 1 Yard No. 3, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100101) preserved, classified as Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.3923.
[0033] The total DNA of strain ST8 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). And design the primer sequence as follows:
[0034] P1: 5'ATGAGTCCAAATAATCAAAAT 3'
[0035] P2: 5'TTACTCTACGTCAACAATTAA 3'
[0036] 25μl PCR reaction system:
[0037]
[0038]
[0039] Thermal cycle reaction: pre-denaturation at 94°C for 5 minute...
Embodiment 2
[0040] Example 2 Obtaining of Cry8Pa1 protein
[0041] According to the sequence at both ends of the open reading frame of the Cry8Pa1 gene, a pair of specific primers were designed and synthesized: cry8R: 5′-CG GAGCTC ATGAGTCCAAATAATCAAAAT-3′; cry8F: 5′-ATTTG CGGCCGC TTACTCTACGTCAACAATTAA-3',
[0042] The bases underlined at the 5' end primers are Sac I and Not I restriction sites, respectively. Amplify using ST8DNA as a template, the amplified product is double digested with Sac I and Not I, and the digested product is connected with the vector pET-32a(+) after the same double digestion, and transformed into E.coli DH5α competent cells, and the recombinant plasmid was named pET-8P. After the enzyme digestion electrophoresis of the recombinant plasmid verified that the size of the inserted fragment conformed to the target fragment ( figure 2 ) into the recipient strain E.coli.BL21(DE3), and the recombinant containing the recombinant plasmid was named E.coli.BL21(8P). ...
Embodiment 3
[0043] Example 3 Anti-insect effect of Cry8Pa1 protein
[0044] The insecticidal activities of cry8Pa1 gene expression products were tested against cotton bollworm, black beetle and North China giant beetle respectively.
[0045] For Lepidoptera pests: prepare Cry8Pa1 protein into 6 different concentrations ranging from 1 μg / ml to 100ng / ml, choose old and tender cabbage leaves, wash and dry; irradiate under ultraviolet light for 15 minutes, cut into 2×2cm 2 Divide into different concentrations of bacterial liquid, soak for 5 minutes; take out and drain the excess liquid, put it in a sterilized petri dish to dry, use LB soaked leaves as a control, put 4 leaves in each petri dish; choose healthy 30 2-3 instar cotton bollworms; each treatment was repeated 3 times, placed indoors, and the larval mortality was investigated after 3 days, and the LC was calculated with SPSS 10.0 software 50 .
[0046] For Coleopteran pests: prepare Cry8Pa1 protein into 6 different concentration gra...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 