Unlock instant, AI-driven research and patent intelligence for your innovation.

Pesticide Bt protein Cry8Pa1 and coding gene and use thereof

A technology that encodes genes and bt proteins, applied in applications, insecticides, genetic engineering, etc., to achieve the effects of reducing costs, improving insect resistance, and good insecticidal activity

Inactive Publication Date: 2013-08-21
SICHUAN AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the inevitable result of frequently making a single Bt insecticidal protein is resistance to Cry-like proteins due to the adaptation of pests; at present, many insect populations have successively developed resistance to insecticidal crystal proteins to varying degrees

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pesticide Bt protein Cry8Pa1 and coding gene and use thereof
  • Pesticide Bt protein Cry8Pa1 and coding gene and use thereof
  • Pesticide Bt protein Cry8Pa1 and coding gene and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Cloning of Cry8Pa1 gene

[0032] The new bacterial strain ST8 of Bacillus thuringiensis isolated from the soil in the plain area of ​​Chengdu, Sichuan Province in the present invention has been obtained in the General Microorganism Center of China Microbiological Culture Collection Management Committee (Address: West Beichen, Chaoyang District, Beijing) on ​​June 12, 2010. Road No. 1 Yard No. 3, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100101) preserved, classified as Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.3923.

[0033] The total DNA of strain ST8 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). And design the primer sequence as follows:

[0034] P1: 5'ATGAGTCCAAATAATCAAAAT 3'

[0035] P2: 5'TTACTCTACGTCAACAATTAA 3'

[0036] 25μl PCR reaction system:

[0037]

[0038]

[0039] Thermal cycle reaction: pre-denaturation at 94°C for 5 minute...

Embodiment 2

[0040] Example 2 Obtaining of Cry8Pa1 protein

[0041] According to the sequence at both ends of the open reading frame of the Cry8Pa1 gene, a pair of specific primers were designed and synthesized: cry8R: 5′-CG GAGCTC ATGAGTCCAAATAATCAAAAT-3′; cry8F: 5′-ATTTG CGGCCGC TTACTCTACGTCAACAATTAA-3',

[0042] The bases underlined at the 5' end primers are Sac I and Not I restriction sites, respectively. Amplify using ST8DNA as a template, the amplified product is double digested with Sac I and Not I, and the digested product is connected with the vector pET-32a(+) after the same double digestion, and transformed into E.coli DH5α competent cells, and the recombinant plasmid was named pET-8P. After the enzyme digestion electrophoresis of the recombinant plasmid verified that the size of the inserted fragment conformed to the target fragment ( figure 2 ) into the recipient strain E.coli.BL21(DE3), and the recombinant containing the recombinant plasmid was named E.coli.BL21(8P). ...

Embodiment 3

[0043] Example 3 Anti-insect effect of Cry8Pa1 protein

[0044] The insecticidal activities of cry8Pa1 gene expression products were tested against cotton bollworm, black beetle and North China giant beetle respectively.

[0045] For Lepidoptera pests: prepare Cry8Pa1 protein into 6 different concentrations ranging from 1 μg / ml to 100ng / ml, choose old and tender cabbage leaves, wash and dry; irradiate under ultraviolet light for 15 minutes, cut into 2×2cm 2 Divide into different concentrations of bacterial liquid, soak for 5 minutes; take out and drain the excess liquid, put it in a sterilized petri dish to dry, use LB soaked leaves as a control, put 4 leaves in each petri dish; choose healthy 30 2-3 instar cotton bollworms; each treatment was repeated 3 times, placed indoors, and the larval mortality was investigated after 3 days, and the LC was calculated with SPSS 10.0 software 50 .

[0046] For Coleopteran pests: prepare Cry8Pa1 protein into 6 different concentration gra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a new Bt protein Cry8Pa1 and a coding gene thereof. The protein has an amino acid sequence represented by SEQ ID No.2 or an amino acid sequence which has one or more amino acid substituted, lost and / or lost compared with the amino acid sequence represented by SEQ ID No.2 and has the same activity. The Bt protein Cry8Pa1 provided by the invention can be used for preparing Btpesticide, the gene coding the protein can convert various plants such as grains, cotton, oil, vegetable and other economic crops, flowers and lawns to enable the plants to have a corresponding anti-pest activity, so the dose of pesticide can be reduced and environment pollution can be reduced. The Bt protein Cry8Pa1 has a high economic value and a bright application prospect.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a novel Bt protein and its coding gene and application. Background technique [0002] In the process of human production, insect pests are an important factor that causes agricultural production losses and affects human health. According to FAO statistics, the annual economic losses caused by insect pests in agricultural production worldwide are as high as 14%, disease losses reach 12%, and weed damage losses reach 11%. %. The loss was as high as 126 billion US dollars, equivalent to half of China's total agricultural output value, and more than four times that of the United Kingdom. Agricultural pests are mainly concentrated in Lepidoptera and Homoptera. Some insects in the Coleoptera Scarabidae, such as grubs, are also important worldwide distribution of underground pests, harming dicotyledonous and monocotyledonous food crops and various vegetables Seeds and seedlings sown by oi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/325C12N15/32C12N15/63C12N5/10A01N63/02A01P7/04A01H5/00
Inventor 李平郑爱萍李巧朱军王世全邓其明李双成王玲霞刘怀年
Owner SICHUAN AGRI UNIV