SSR (Simple Sequence Repeat) marker tightly interlocked with cucumber fruit bitter gene Bt and application thereof

Abstract

The invention provides an SSR (Simple Sequence Repeat) marker tightly interlocked with a cucumber fruit bitter gene Bt and an application thereof, and relates to a biological breeding auxiliary technology. The sequence of the marker is as follows: SSR21558-F/SSR221558-R: GTGGGGGATGTGATT CAGAC/CATCATCCATTCCCCTCAAC, wherein the amplified characteristic stripe is (175bp) represented by Seq ID No.1 and (192bp) represented by Seq ID No.2; and SSR20054-F/SSR20054-R: GTTTGTGAGGGAAACGCAAT/TCAAAAAGCTTCCTTCCTTCA, wherein the amplified characteristic stripe is (127bp) represented by Seq ID No.3 and (108bp) represented by Seq ID No.4. Two markers are more tightly interlocked with the gene Bt so as to be more helpful to the establishment of a cucumber fruit bitter molecular marker breeding auxiliary system; with the adoption of the SSR marker obtained by the system, the screening of fruit bitterness or no fruit bitterness is carried out on a cucumber candidate material at any phase, so as to have the advantages of high efficiency, less limitation and accuracy, and improve the selection efficiency and accuracy for selecting bitter-free materials for cucumber breeding.

Description

technical field [0001] The invention relates to biological breeding auxiliary technology, in particular to a closely linked SSR marker of cucumber fruit bitterness gene Bt and its application. Background technique [0002] In the production of cucumber (Cucumis sativus L.), especially in protected cultivation, sometimes bitter fruits are produced, resulting in loss of income (Rehm et al., 1957; Gu Xingfang et al., 2000; Kano et al., 2002). The bitter taste of melons is caused by a class of substances called cucurbitacins (Rice et al., 1981; Balkema et al., 2003). Cucurbitacins belong to the cucurbitane-type tetracyclic triterpenoids, which are toxic to most organisms (Smyth et al., 2002). Fruit bitterness is one of the problems affecting cucumber production. Dutch cucumber breeders had started breeding non-bitter cucumbers as early as 1959, and bred corresponding varieties whose vegetative organs and fruits had no bitter taste (AndeweG and Bruyn, 1959). Studying the molec...

AI Technical Summary

Problems solved by technology

[0006] At present, the methods for detecting the bitterness of cucumber are mostly sensory tasting and chemical detection. Although chemical detection can detect a large number of materials, it is cumbersome and the results are not accurate enough; sensory tasting is only suitable for the detection of a small amount of materials, and cannot be accurately graded ( Gu Xingfang et al., 2004), so it is urgent to establish a set of methods for quickly and accurately identifying bitterness, so as to provide a theoretical basis for cultivating non-bitter-tasting cucumbers

Images