Supercharge Your Innovation With Domain-Expert AI Agents!

SSR (Simple Sequence Repeat) marker tightly interlocked with cucumber fruit bitter gene Bt and application thereof

A technology of fruit bitterness gene, SSR21558-F, which is applied in application, plant genetic improvement, microbial measurement/inspection, etc. It can solve the problems of tediousness, inability to carry out precise grading, and inaccurate results.

Active Publication Date: 2012-09-26
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the methods for detecting the bitterness of cucumber are mostly sensory tasting and chemical detection. Although chemical detection can detect a large number of materials, it is cumbersome and the results are not accurate enough; sensory tasting is only suitable for the detection of a small amount of materials, and cannot be accurately graded ( Gu Xingfang et al., 2004), so it is urgent to establish a set of methods for quickly and accurately identifying bitterness, so as to provide a theoretical basis for cultivating non-bitter-tasting cucumbers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SSR (Simple Sequence Repeat) marker tightly interlocked with cucumber fruit bitter gene Bt and application thereof
  • SSR (Simple Sequence Repeat) marker tightly interlocked with cucumber fruit bitter gene Bt and application thereof
  • SSR (Simple Sequence Repeat) marker tightly interlocked with cucumber fruit bitter gene Bt and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1. Screening of cucumber fruit bitterness gene Bt-linked SSR markers

[0032] Step 1. Identification of Cucumber Fruit Bitterness

[0033] The cucumber materials for testing were sown and raised on March 14, 2010, and planted in the spring greenhouse of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences on April 16. planting parent and F 1 30 plants each (3 replicates, 10 plants per replicate), F 2 189 strains. Seedling routine management. After planting, the night temperature in the early stage is controlled below 12°C, and the daytime temperature in the later stage is higher than 32°C. Water is controlled throughout the growth period, and nitrogen fertilizer is added to induce the full expression of bitterness genes. Referring to the method of Li Xingfang et al. (2004), the fruit bitterness was identified by mouth tasting. From the root melon to the end of the test (1 growing season), if each plant has bitter taste 4 times, ...

Embodiment 2

[0066] Example 2. Verification of Bt gene double-flanked SSR markers

[0067]Using 20 cucumber materials of different ecological types collected in this project, the markers closely linked to both sides of the Bt gene were verified to determine the accuracy of the markers SSR21558 and SSR20054 for molecular marker-assisted selection. The phenotypes of these 20 individual plants are: 18 fruit are not bitter; 2 fruit are bitter. The analysis results using the marker SSR21558 showed that the target bands were amplified in all 20 materials, and compared with the field phenotype, the detection accuracy was 95.0%. Another marker linked to the Bt gene, SSR20054, was used to verify the above materials, and the target band was amplified in 20 copies of DNA. Compared with the field phenotype, the detection accuracy rate was 75.0%, and the two markers were used to confirm each other. The verification accuracy can reach 95.0%.

[0068] In this study, the SSR linkage map of the cucumber ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an SSR (Simple Sequence Repeat) marker tightly interlocked with a cucumber fruit bitter gene Bt and an application thereof, and relates to a biological breeding auxiliary technology. The sequence of the marker is as follows: SSR21558-F / SSR221558-R: GTGGGGGATGTGATT CAGAC / CATCATCCATTCCCCTCAAC, wherein the amplified characteristic stripe is (175bp) represented by Seq ID No.1 and (192bp) represented by Seq ID No.2; and SSR20054-F / SSR20054-R: GTTTGTGAGGGAAACGCAAT / TCAAAAAGCTTCCTTCCTTCA, wherein the amplified characteristic stripe is (127bp) represented by Seq ID No.3 and (108bp) represented by Seq ID No.4. Two markers are more tightly interlocked with the gene Bt so as to be more helpful to the establishment of a cucumber fruit bitter molecular marker breeding auxiliary system; with the adoption of the SSR marker obtained by the system, the screening of fruit bitterness or no fruit bitterness is carried out on a cucumber candidate material at any phase, so as to have the advantages of high efficiency, less limitation and accuracy, and improve the selection efficiency and accuracy for selecting bitter-free materials for cucumber breeding.

Description

technical field [0001] The invention relates to biological breeding auxiliary technology, in particular to a closely linked SSR marker of cucumber fruit bitterness gene Bt and its application. Background technique [0002] In the production of cucumber (Cucumis sativus L.), especially in protected cultivation, sometimes bitter fruits are produced, resulting in loss of income (Rehm et al., 1957; Gu Xingfang et al., 2000; Kano et al., 2002). The bitter taste of melons is caused by a class of substances called cucurbitacins (Rice et al., 1981; Balkema et al., 2003). Cucurbitacins belong to the cucurbitane-type tetracyclic triterpenoids, which are toxic to most organisms (Smyth et al., 2002). Fruit bitterness is one of the problems affecting cucumber production. Dutch cucumber breeders had started breeding non-bitter cucumbers as early as 1959, and bred corresponding varieties whose vegetative organs and fruits had no bitter taste (AndeweG and Bruyn, 1959). Studying the molec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68A01H1/04
Inventor 顾兴芳张圣平苗晗王烨
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More