Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

184results about How to "Improve selection accuracy" patented technology

Control method of searching neighboring cells, mobile station, and mobile communication system

A control method of searching for a neighboring cell of a mobile station communicating with a base station is provided in a direct sequence CDMA mobile communication system which transmits information by carrying out double modulation using a first spreading code group and a second spreading code. The first spreading code group includes spreading codes that have a same repetition period as an information symbol period and are used in common by the base stations, and the second spreading code has a repetition period longer than the information symbol period. The base stations are assigned different second spreading codes. The control method stores at least one second spreading code and its phase into a first table, which second spreading code corresponds to a perch channel whose second spreading code and phase are known; stores a second spreading code used by a neighboring base station into a second table; searches for a perch channel whose second spreading code and phase are unknown; and searches for a perch channel whose second spreading code and phase are known. The neighboring cell search method can save the power consumption and time required for the mobile station to carry out the cell search with preventing an increase in the total cost of the system.
Owner:NTT DOCOMO INC

Cultivating method of laying hen with low egg yolk cholesterol content

The invention discloses a cultivating method of a laying hen with low egg yolk cholesterol content. The cultivating method of the laying hen with the low egg yolk cholesterol content comprises the following steps: 1, using deoxyribonucleic acid (DNA) sequence containing very low density lipoprotein receptor (VLDLR) gene of the laying hen as a template, designing a primer, and using polymerase chain reaction(PCR) to restriction fragment length polymorphism (RELP) method to conduct sample hen individual genotyping; 2, using a gene effect analysis model to determine select and remain genotype; 3, establishing a family of cock and hen individuals conforming to the select and remain genotype; 4, extracting DNA of offspring of hens of a select and remain genotype family, using the primer in the step 2 to conduct PCR-RFLP analysis, and selecting and remaining hens of the select and remain genotype in the step 2; 5, repeating the step 3 and the step 4 subculture and seed selection at least three generations, and obtaining laying hens with the low egg yolk cholesterol content. The cultivating method of the laying hen with the low egg yolk cholesterol content adopts a VLDLR gene molecular marker assisted select breeding method, egg yolk cholesterol contents of the cultivated laying hens can decrease more than 20 percentages compared with the original level.
Owner:HENAN AGRICULTURAL UNIVERSITY

Webpage topic sentence extraction method and apparatus

An embodiment of the invention provides a webpage topic sentence extraction method. The method comprises: firstly, obtaining a to-be-determined webpage, wherein the to-be-determined webpage contains a plurality of alternative topic sentences, and each alternative topic sentence contains a plurality of segmented words; secondly, determining a word feature value of each segmented word, inputting the word feature value into a preset machine learning model to obtain a partial order value of the segmented word, and further according to the partial order value of the segmented word, determining a partial order value of each alternative topic sentence; and finally, determining the alternative topic sentence with the partial order value greater than a preset threshold as a target topic sentence. According to the embodiment of the invention, the partial order values of the alternative topic sentences are obtained by utilizing the machine learning model; the machine learning model can reflect a degree of correlation between a query statement and a recalled webpage, so that the determined partial order values are more accurate and the accuracy of selecting the target topic sentence is improved. In addition, the invention furthermore provides a webpage topic sentence extraction apparatus, which is used for ensuring the application and implementation of the method in practice.
Owner:ALIBABA (CHINA) CO LTD

Laser line key point extraction method based on plane target

The invention relates to the technical field of calibration methods of line structured light vision systems, in particular to a laser line key point extraction method based on a plane target. The method is characterized by comprising the following steps: S1, binarization of a target image: converting a gray level image obtained by a CCD black and white camera into a binary image; S2, morphologicalimage processing: respectively carrying out corrosion and opening operation processing on the target binary image, and subtracting the result of the opening operation and the result of the corrosionoperation to remove useless information interference in the target image so as to obtain laser ray key image information; S3, Hough linear transformation: acquiring a laser line two-dimensional equation; S4, extracting of two-dimensional coordinates in the image coordinate system on the target laser line. The method has the advantages that the laser line equation extracted through the method can accurately calculate the image coordinate points on the laser line, and the measurement accuracy of the system is greatly improved.
Owner:LASER RES INST OF SHANDONG ACAD OF SCI +1

Deep learning algorithm based on multi-task and nearby information fusion for object detection

The invention discloses a multi-task and proximity information fusion depth learning algorithm based on object detection, which comprises the steps: pictures are input, image features by using a convolution neural network are extracted, and target candidate frames are generated; using the image features, the image is passed through the region candidate network to extract the target prediction frame; feature extraction and feature pooling of the target prediction frame, then the border regression, direction prediction, target detection and classification are performed to get the preliminary detection results; the preliminary detection result is fused with the target candidate frame and enters the ROI pooling layer and passes through the second full connection layer to obtain the final detection result; the classification of target detection is to redefine the confidence score of a target prediction box by using the information relationship between the target prediction box and its neighboring other target prediction boxes. The algorithm adopts multi-task output mode. The invention not only improves the speed of the target detection, but also ensures the accuracy of the target detection and achieves the requirement of the real-time target detection.
Owner:FOSHAN SHUNDE SUN YAT SEN UNIV RES INST +2

Corn variety breeding method

The invention provides a corn variety breeding method. The corn variety breeding method comprises the steps of drought resistance screening of a basic material, drought resistance screening of a selfing line F1-generation, drought resistance screening of a selfing line F2-generation, yield increase screening of a selfing line F3-generation, drought resistance screening of a selfing line F4-generation, hybrid preparation, drought-resisting and high-yield hybrid breeding and the like. In different generations, by adopting the method for identifying three types of drought resistance by introducing repeated drought-condition seedling survival rate, drought resisting indexes and 'three controls and three selections' according to the different characteristics of the generations, comprehensive assessment on drought resistance is performed, results are accurate and reliable, and the line selecting accuracy is improved.
Owner:DRY LAND FARMING INST OF HEBEI ACAD OF AGRI & FORESTRY SCI

SSR (Simple Sequence Repeat) marker tightly interlocked with cucumber fruit bitter gene Bt and application thereof

The invention provides an SSR (Simple Sequence Repeat) marker tightly interlocked with a cucumber fruit bitter gene Bt and an application thereof, and relates to a biological breeding auxiliary technology. The sequence of the marker is as follows: SSR21558-F/SSR221558-R: GTGGGGGATGTGATT CAGAC/CATCATCCATTCCCCTCAAC, wherein the amplified characteristic stripe is (175bp) represented by Seq ID No.1 and (192bp) represented by Seq ID No.2; and SSR20054-F/SSR20054-R: GTTTGTGAGGGAAACGCAAT/TCAAAAAGCTTCCTTCCTTCA, wherein the amplified characteristic stripe is (127bp) represented by Seq ID No.3 and (108bp) represented by Seq ID No.4. Two markers are more tightly interlocked with the gene Bt so as to be more helpful to the establishment of a cucumber fruit bitter molecular marker breeding auxiliary system; with the adoption of the SSR marker obtained by the system, the screening of fruit bitterness or no fruit bitterness is carried out on a cucumber candidate material at any phase, so as to have the advantages of high efficiency, less limitation and accuracy, and improve the selection efficiency and accuracy for selecting bitter-free materials for cucumber breeding.
Owner:INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI

A method for optimizing design of building aseismic support and hanger type selection

A method for optimizing design of building aseismic support and hanger type selection includes the steps of arranging and assembling main accessories in seismic support and hanger according to different type to obtain all combination types of main accessories of seismic support and hanger; calculating the design bearing capacity and cost of the aseismic support and hanger corresponding to each combination type are calculated by choosing the combination type which accords with the aseismic support and hanger layout form among all the combination types of the main accessories of the aseismic support and hanger. The design bearing capacity of each type of aseismic support and hanger is transformed into the maximum mass of the mechanical and electrical pipelines. According to the type and quality of mechanical and electrical pipelines and the maximum quality and cost of mechanical and electrical pipelines can be borne by the corresponding seismic support and hanger of each different combination type, the optimal combination type is selected in different combination types. The invention can effectively select the optimal combination scheme from the combination schemes of different typesof the main accessories of the seismic support and hanger, has high safety and low cost, and can meet the related requirements.
Owner:NANJING SOUTHEAST BUILD ELECTROMECHANICAL SEISMIC RES INST

Information recommendation list generation method and device

Embodiments of the invention disclose an information recommendation list generation method and device. The method comprises the following steps of: obtaining feature data of each to-be-recommended object in a to-be-recommended object set by a terminal, wherein the to-be-recommended object set comprises S1 to-be-recommended objects; obtaining a preset feature data set by the terminal, wherein the preset feature data set comprises feature data of S2 recommended objects, the feature data of the S2 recommended objects comprises feature data of an appointed recommended object, and S2 is smaller than or equal to S1; calculating a recommendation value of each to-be-recommended object by the terminal according to the preset feature data set and the feature data of the S1 to-be-recommended objects;and selecting a target recommended object by the terminal according to the recommendation value of each to-be-recommended object in the S1 to-be-recommended objects, and adding the target recommendedobject to an appointed display position in a recommendation list. By adoption of the method and device, the advantages of improving the recommended object selection correctness and improving the resource utilization rate of the recommendation list are provided.
Owner:HUAWEI TECH CO LTD

Sub-block motion prediction and coding method, coder and storage device

The invention discloses a sub-block motion prediction and coding method, a coder and a storage device, and the method comprises the steps: obtaining a reference block, a co-located frame and a reference frame of a current block, and the number of at least one of the reference block, the co-located frame and the reference frame being greater than one; obtaining motion vectors of the current blocks,wherein the motion vector of each current block corresponds to a group of reference parameters; obtaining a common position block of a plurality of sub-blocks based on each group of reference parameters, the plurality of sub-blocks being obtained by dividing the current block, the common position block of the sub-blocks being a block where a first offset point is located in a co-located frame, and the first offset point being a point after a specified point in the sub-blocks offsets a reference motion vector; obtaining candidate motion vectors of the sub-blocks by utilizing the motion vectorsof the common position blocks of the sub-blocks; and obtaining a sub-block motion prediction result of the current block based on all candidate motion vectors of the sub-block according to the principle of minimum prediction cost. In this way, the prediction accuracy can be improved.
Owner:ZHEJIANG DAHUA TECH CO LTD

Nerve stimulation apparatus and biomagnetic field measurement system

A nerve stimulation apparatus is provided. The nerve stimulation apparatus detects nerve activities from a body surface and applies stimulation. The nerve stimulation apparatus includes a stimulation apparatus with multiple electrodes which are arranged on skin and a current supply unit which supplies a current to the electrodes, which stimulation apparatus provides the current to a living body percutaneously to stimulate a target nerve; a measurement apparatus which measures activities of muscles governed by the nerve according to the stimulation from the stimulation apparatus; and an information processing apparatus which determines, based on a measurement result of the nerve activities obtained from the measurement apparatus, which electrode is capable of providing the target nerve activities equal to or greater than a desired value.
Owner:RICOH KK +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products