59 results about "Expression index" patented technology

The invention provides an expression search engine which comprises a communication module and an expression index module, wherein the communication module is used for receiving expression labeling information containing expression pictures and corresponding labeling texts; and the expression index module is used for generating an expression index file according to the expression labeling information. Compared with the prior art, the invention has the advantages that the expression search engine and an expression management system are used for acquiring the labeling information of expressions and establishing an index, so that sets of relevant expressions can be quickly researched through the labeling information of the expressions while an expression research service is provided, and a research result list can be returned, thereby the quantity of recalled effective results and the researching accuracy are improved, and the qualities of returned expressions are improved; and in addition, the expression picture sets can be sequenced through relevant coefficients, thus a user can quickly find out interested pictures from the research result list, and thereby the using convenience of the user is improved, and the network flow is saved.

The invention discloses a classroom teaching effect evaluation system based on facial expression recognition. According to the invention, videos in a classroom are analyzed in real time; the facial expressions of students in class are extracted, and the understanding degree, the activity degree, the doubtful degree and the activity time index information of the students in class are counted and analyzed, so that teachers can know the psychological states of the students and the mastery degree of the students on the knowledge points, the teachers can adopt corresponding teaching regulation andcontrol means, and the teaching quality of the class is improved; The classroom expression state of the teacher is automatically analyzed, the classroom expression index of the teacher is counted, andthe classroom emotion basis is provided for teaching management personnel to examine the teacher. The classroom expressions of teachers and students are recorded, the classroom expression indexes ofthe teachers and the students are obtained through statistical analysis, and the indexes serve as reference indexes for classroom teaching evaluation and have comprehensiveness and objectivity. the classroom teaching effect of the target course in each school for course reform is counted as a reference. Through the technical scheme of the invention, teachers and teaching management personnel can better accomplish the teaching concept taking students as the main part.

The embodiment of the invention provides a brand evaluation method and a brand evaluation device. The method comprises the steps: receiving a brand keyword and a brand attribute; determining a brand data source associated with the brand attribute in the Internet and acquiring brand data associated with the brand keyword from the brand data source; and exposing and analyzing the brand data associated with the brand keyword to determine an expression index of the brand keyword, carrying out text analysis on the brand data associated with the brand keyword to determine a value index of the brand keyword, carrying out forward movement analysis on the brand data associated with the brand keyword to determine a recommended index of the brand keyword, and calculating the weighted values of the expression index, the value index and the recommended index according to a predetermined weight.

The invention provides and discloses an optimized nucleotide sequence of alkaline pectinase pel168s and a high-level expression method thereof. According to the method, a pel168 gene sequence (wherein the gene is Bacillus subtilis 168 the accession number of which in a GenBank is AL009126) is optimized by DNA works software, restriction enzyme cutting sites SalI and PmeI are shielded, a restriction enzyme cutting site EcoRI is added at the 3' end of a primer, and a restriction enzyme cutting site NotI is introduced at the 5' end of the primer. After the procedures of PCR (Polymerase Chain Reaction) amplification, connection transformation and sequencing verification, the optimized gene sequence of the alkaline pectinase pel168s is obtained. Recombinant plasmid pel168s-9k is constructed according to the sequence, and then is transformed into pichia yeast GS115, thereby obtaining a positive recombinant strain GS115 / pel168s-9k. According to the invention, when alkaline pectinase is produced by adopting the optimized nucleotide sequence of the alkaline pectinase pel168s and utilizing the pichia yeast, the target protein expression index is high, the purge process is simple, the production cost of the alkaline pectinase is reduced greatly, and the utilization rate of an enterprise on the alkaline pectinase is enhanced.

The invention provides an establishing method of a preoperative prediction model for the lung cancer cell KI-67 expression index. The establishing method comprises the following steps: (1) screening cases, thus obtaining patients meeting the standards; (2) detecting the KI-67 expression index of the patients; (3) carrying out CT image scanning and three-dimensional reconstruction on the lungs of the patients, thus obtaining CT parameter data and three-dimensional images; and (4) carrying out statistical processing and analysis and cross validation on the CT parameter data and the KI-67 expression index, and establishing the prediction model for KI-67. According to the establishing method, the relevant CT parameters measured in the GGO (ground-glass opacity) three-dimensional reconstruction model and having good objectivity and accuracy are associated with the lung cancer cell KI-67 expression index in pathological samples innovatively, and the multiple regression model for predicting KI-67 LI by adopting the three-dimensional reconstruction parameters is established by researching the quantization coherence of the relevant CT parameters and the lung cancer cell KI-67 expression index.

The invention relates to a method for taking the breast cancer molecular marker S100A8 / A9 in diagnosis and prognosis evaluation of the breast cancer. According to the method, results show that the expression indexes of the molecular marker S100A8 / A9 in breast cancer patients with different molecular pathological subtypes are different, that is, thesubtypemolecular marker S100A8 / A9 is highly expressed in a substrate cellular type (basal-like) breast cancer patient and a Her-2 amplified) overexpression type breast cancer patient, but is relatively low in expression index in a lumen epithelia A type (Luminal A) breast cancer patient and a lumen epithelia B type (Luminal B) subtype breast cancer patient, that is, the statistic difference is obvious. For published NKI breast cancer chip data, patients are divided into a high group and a low group based on S100A8 / A9 for Kaplan-Meier survivorship curve analysis, results show that the negative correlation between the S100A9 expression level and the total survival rate is obvious, the prognosis of a breast cancer patient with high S100A9 expression is poor, and the prognosis application value of prompting breast cancer is high.

The invention relates to a method for eliminating dependence of a methanol-induced promoter on a single methanol carbon source. By means of increasing the expression index of an Mit1 polypeptide in a methylotrophic yeast cell and activating the expression of a promoter to be induced by methanol, the promoter which is originally dependent on the methanol for induction can be also used for expressing foreign polypeptides without depending on single methanol.

The invention discloses a gene for coding a recombinant human TNFR-Fc fusion protein and an application of the gene. The gene for coding the recombinant human TNFR-Fc fusion protein as shown in SEQ ID NO.1 is obtained by optimized screening of codons. The gene has high expression index in a CHO (Chinese Hamster Ovary) cell, and the expressed protein has high affinity with TNFR. The gene is transferred into the CHO cell to obtain a cell for expressing the recombinant human TNFR-Fc fusion protein. The CHO cell into which the gene is transferred is fermented by using a disposable reactor, the operation is simple, and the obtained protein quantity is higher in comparison with the conventional fermentation tank; and especially after a supplemented medium is added, the cell growth time can be prolonged, the expression level can be increased, the production cost can be reduced, and a high-purity target protein can be obtained.

The invention relates to synthetic signal peptide and application thereof. The amino acid sequence of the signal peptide is SEQ ID NO:2. The signal peptide can be added to a mammalian cell expression vector and used for leading mammalian source protein secretion expression, and the foreign protein expression index of the signal peptide in mammalian cells can be improved.

The invention belongs to the technical field of cell engineering, and particularly relates to an efficient screening method of an exogenous protein expression cell strain. The efficient screening method of the exogenous protein expression cell strain disclosed by the invention comprises the following steps: using an interest protein expression vector to transfect host cells; pressurizing a screening drug, and forming a stable cell pool; inoculating a semisolid culture medium with the cells in the stable cell pool; transferring the cloned cells from the semisolid culture medium to a 96-hole cell plate to be continuously cultured for 4-5 days, and detecting the interest protein expression index in the cell supernatant; transferring cells which are first 50 in the ranking of expression index to a 24-hole plate to be continuously cultured for 5 days; further transferring the cells in the 24-hole plate to a 6-hole to be continuously cultured for 5 days; transferring the cells in the 6-hole plate to a shake flask for culture, and detecting and evaluating the interest protein expression indexes of different cloned cells under a suspension state; according to the evaluation result in the shake flask, performing a stability passage test on the cells which are first 10 in the ranking of the expression index; according to the interest protein expression level of the cell strain and the stability of the continued expression protein, determining the candidate cell strains.

The invention discloses an expression system of fusion protein from human serum albumin and interleukin-1 receptor antagonist. The expression system comprises a host cell and an expression vector transferred into the same. The expression vector comprises a first expression vector with an inserted fusion protein gene and a second expression vector with an inserted protein disulfide isomerase gene.The fusion protein gene comprises the human serum albumin and the interleukin-1 receptor antagonist. The host cell is Pichia pastoris GS115. The co-expression host of PDI (protein disulfide isomerase) and IGH (immunoglobulin heavy) is established, and expression index of the IGH is evidently increased. The PDI is expressed intracellularly, the IGH secretory expression is subjected to extracellular secretory expression, and accordingly no newly generated other proteins occur when concentration of the IGH in collected medium supernate increases.

The invention relates to a video pushing method and device based on micro-expressions, computer equipment and a storage medium. The method comprises the following steps: receiving a face image and a currently played video identifier sent by a terminal, wherein the face image is acquired in the playing process of a currently played video corresponding to the currently played video identifier and corresponds to a first problem inserted into the currently played video; processing the face image based on a micro-expression recognition model to obtain a micro-expression index, wherein the micro-expression index is used as a reference index for judging whether a user masters knowledge points in the currently played video or not; when the micro-expression index is greater than a first preset value, obtaining a video category corresponding to the currently played video identifier; obtaining an initial video corresponding to the video category, and extracting a first problem corresponding to the face image from a currently played video corresponding to the currently played video identifier; and selecting a target video from the initial videos according to the first problem, and pushing thetarget video to the terminal. By adopting the method, the operation can be simplified.

The embodiment of the invention provides a photo taking method, a photo taking device and a mobile terminal, and relates to the technical field of mobile terminals. The photo taking method comprises the steps that an original image acquired by a camera is acquired; at least one feature information in the original image is detected; corresponding feature evaluation indexes are determined accordingto the at least one feature information, wherein the feature evaluation indexes comprise the expression index or the sentiment index; and the feature evaluation indexes are displayed. The corresponding expression index or sentiment index is determined according to the detected feature information and displayed, and by means of the level of the expression index or sentiment index, a user is guidedto shoot a photo with the better effect, and the photo taking interestingness is improved.

The invention discloses gene engineering bacteria high-efficiently expressing recombined human glucagon-like peptide-1 (1-37). The gene engineering bacteria is Escherichia coli DH5alpha and BL21(DE3) carrying recombined plasmid, wherein the recombined plasmid is the plasmid pET32a (+) containing human glucagon-like peptide-1 (1-37). The invention also discloses a construction method of the gene engineering bacteria, which is characterized in that the pET32a (+) - GLP -1 (1-37) is adopted as a template, a primer is designed according to an alkaline base of the GLP-1 (1-37) gene, the gene GLP-1 (1-37) is obtained through the polymerase chain reaction (PCR) augmentation, through the enzyme digestion, the gene GLP-1 (1-37) is inserted into the plasmid pET32a(+), the recombined plasmid pET32a (+)-GLP-1(1-37) is constructed and is converted into Escherichia coli. The recombined human glucagon-like peptide-1 (1-37) prepared by the method has advantages of low cost, high expression index, simple and convenient purification step, easiness in operation and high yield.

The invention relates to a kit for detecting an expression index of mRNA (messager Ribose Nucleic Acid) of a WT1 (Wilms Tumor 1) gene, and belongs to the field of biotechnology. The kit comprises detection primers, a fluorescent probe, a cDNA (complementary Deoxyribose Nucleic Acid) first strand synthesis reagent, a fluorescent quantitative PCR (Polymerase Chain Reaction) mixed solution, negative reference and positive reference, wherein the detection primers and the fluorescent probe comprise a WT1 gene primer, an internal reference gene ABL primer and a Taqman fluorescent probe. The WT1 gene is related with hematopoietic tumor incidence, is of over-expression in about 80% of patients with newly diagnosed acute myelocytic leukemia and acute lymphocytic leukemia, is recognized as a leukemia marker gene, and can serve as an independent minimal residue disease monitoring and prognosis prompting index. The level of the mRNA of the WT1 gene is detected by adopting a fluorescent quantitative PCR technology with higher sensitivity and specificity, and both the specificity and the sensitivity of a detection result are remarkably improved. The kit provides a brand-new quick, simple and convenient gene diagnosis technology for prognosing the acute myelocytic leukemia and the acute lymphocytic leukemia and confirming chemotherapy regimens.

The invention discloses a kit for detecting a relative expression index of a leukemia BCR / ABL (m-bcr) fusion gene. The kit comprises a red blood cell lysis solution, TRIzol, chloroform, absolute ethanol, ReverTraAceqPCRRTKit, a detection system PCR (Polymerase Chain Reaction) reaction solution, a positive control sample and a negative control sample, and is characterized in that the detection system PCR reaction solution comprises THUNDERBIRDqPCRMIX, upstream and downstream primers m-bcr-F and m-bcr-R and a probe m-bcr-Probe for detecting target genes, and primers ab1-F and ab1-R and a probe ab1-Probe for detecting internal reference genes Ab1, wherein the m-bcr-F is GGCGCCTTCCATGGAGAC, the m-bcr-R is TCCTTGGAGTTCCAACGA, the m-bcr-Probe is TTTGAGCCTCAGGGTCTGAGTGAA, the ab1-F is GCCGTGAAGACCTTGAAGGAG, the ab1-R is ATGATATAGAACGGGGGCTC, and the ab1-Probe is FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA.

The invention relates to a miRNA expression model for diagnosing hepatic diseases independently. In the invention, an expression model of a miR-885-5p which is one of the circulating miRNAs associated with hepatic diseases is built by analyzing the types and relative expression levels of potential circulating miRNAs in a serum sample of a patient with cirrhosis or hepatocellular carcinoma and comparing the expression levels of the potential circulating miRNAs with the expression abundance of the circulating miRNAs in healthy reference serum. The model is formed by the expression indexes of the miR-885-5p, wherein the expression level of the miR-885-5p is higher than that of a healthy reference and is less tan 0.0001. ROC curve analysis shows that the hepatic disease HCC, LC and CHB identification efficacy AUC of the miR-885-5p and the healthy reference is 0.904, and the sensitivity and specificity of the miR-885-5p and the healthy reference are 90.5 percent and 79.2 percent respectively.

The invention discloses orally-taken recombined fusion protein TAT-MAP30, a preparation method and applications. The genetic engineering technology is used for combining cell-penetrating peptide TAT and elaterin MP30, Escherichia coli is converted, and a genetically engineered bacterium capable of producing the TAT-MAP30 fusion protein is obtained, CCTCC NO: M2013546. The obtained TAT-MAP30 fusion protein has the ability of quickly penetrating through a midgut cytomembrane, can lower protein loss caused by the organism biological barrier, the physical barrier and the chemical barrier, and can be used as oral drugs for prevention and treatment of bacterium resistance and virus resistance of vertebrate and invertebrate, and the fusion protein is high in expression index and easy to purify and has important application prospects and practical significance.

Provided is a method for improving transient expression of recombinant proteins through improvement of transfection efficiency, wherein the transfection efficiency is improved through changing of environment of cells before and after transfection. The method enables expression index of the transient transfection recombinant proteins to be improved by 37% to 56%.

The invention discloses a self-induced medium and an application thereof. The self-induced medium is composed of 2-10g / L of arabinose, 0.5-2.5g / L of glucose, 5-25g / L of glycerol, 8-12g / L of peptone, 6.5-7.4g / L of phosphate, 1.1-1.3g / L of sulfate, 2.6-2.7g / L of NH4Cl and an appropriate amount of trace element solution. The self-induced medium is used in producing penicillin amidase. Compared with the prior art, the self-induced medium disclosed by the invention has the advantages of strong regulation performance and high protein expression index by utilizing the arabinose as a substrate to induce the expression of an interest protein. In one specific embodiment, the enzyme activity of the penicillin amidase reaches 6U / mL, which is much higher than the protein expression index induced by lactose, and thus providing an important guiding significance for a new process of developing and producing penicillin amidase.

The invention discloses a recombinant protein of active segment IsdB2 of decision protein IsdB on the surface of methicillin-resistant staphylococcus aureus iron ion, wherein the amino acid sequence of the recombinant protein is SEQ ID No: 3 or the sequence which has the same or similar function as the SEQ ID No: 3 obtained by adding or deleting a plurality of amino acids at the amino terminal and / or the carboxyl terminal of the SEQ ID No: 3. The invention further discloses a method for preparing the recombinant protein by building the expression vector of the recombinant protein and transforming the host bacteria, and the use of the recombinant protein in the aspect of preparing the subunit vaccine and the related assay kits resisting the methicillin-resistant staphylococcus aureus. By adopting the gene engineering technology, in the invention, the truncated protective antigens component IsdB2 is expressed by cloning through the protein expressing, thereby being high in expression index, convenient to separate and purify, and high-efficiency and safe. Due to the gene engineering, the recombinant polyvaccine has good immune protective effect on resisting the MRSA (methicillin-resistant staphylococcus aureus) infection.

The invention discloses a porcine circovirus II type capsid protein gene, construction of an expression vector and an efficient expression method of proteins of the porcine circovirus II type capsid protein gene. A sequence of the modified porcine circovirus II type capsid protein gene disclosed by the invention is shown as SEQ ID NO.1. The invention also discloses a preparation method of proteins of the porcine circovirus II type capsid protein gene and particularly relates to the modification of the porcine circovirus II type capsid protein gene, gene cloning and steps including the modification of operation methods such as efficient expression in pichia pastoris, protein capture time and method, protein content and antigenicity detection and the expansion of cultural conditions. The method disclosed by the invention is simple and practicable and low in cost, and realizes the efficient expression of the porcine circovirus II type capsid protein in pichia pastoris, in which the expression index in a test tube or a shake flask is greater than 218 mg / L, thus providing a foundation for the porcine circovirus II type antibody detection and the subunit vaccine development.

The invention relates to the technical field of computers, and discloses a video-based target expression generation method and device, a medium and electronic equipment. The method comprises the stepsof reading a video in response to a target expression making instruction triggered by a user; recognizing a face image in the video to obtain a clear target picture with the face image; analyzing theexpression of the face image in the target picture in real time to obtain an expression index of the expression of the face image in the target picture; and generating a target expression according to the expression indexes of the facial image expressions in all the target pictures. According to the method, the face image in the video is intercepted, and the target expression is generated according to the expression index of the face image expression, so that the expression making process can be simplified, the made expression is enabled to be more real and vivid, and the user experience is improved.

The invention discloses a clinical machine withdrawal prediction system. The system at least comprises a clinical dynamic monitoring module, a symptom index acquisition module, an index data calculation module and a display module, wherein the clinical dynamic monitoring module is used for obtaining the dynamic index data of a clinical patient; the symptom index acquisition module is connected to the clinical dynamic monitoring module, and the symptom index acquisition module acquires symptom expression index data according to clinical symptoms and patient data in a global medical database; the index data calculation module is connected to the symptom index acquisition module, and the index data calculation module constructs an optimal analysis model according to the symptom expression index data; and the display module is connected to the index data calculation module and the clinical dynamic monitoring module, and the display module establishes a treatment dependence graph according to the optimal analysis model to guide machine withdrawal. According to the invention, a clinician can be helped to carry out precise machine withdrawal prediction on a sepsis patient.

The invention provides a method for massively producing human thymosin with low cost. The method is used for implementing restriction enzyme digestion to obtain a fusion gene sequence with a structure as follows: A-X-C, wherein A is a nucleotide sequence of site (1-150)-(1-372) amino acids at the N- end of coded mature human serum albumin; X is the nucleotide sequence of connecting peptide with enterokinase or tobacco etch virus (TEV) protease cutting site contained in a code; and C is a human thymosin gene. The method comprises steps as follows: connecting the fusion gene sequence to an expression carrier; transforming and introducing the expression carrier into saccharomycetes; carrying out induction expression to obtain soluble human serum albumin-thymosin fusion protein; then adding the TEV protease for cutting; and separating and purifying to obtain the recombined human thymosin. The human thymosin production method provided by the invention has the advantages that consistency of quality of products can be ensured, no limitation is generated from sources of raw materials, cost is low, an expression index is high, and mass production can be achieved and the like.

The invention discloses function of actin new methylation, namely 84 lysine monomethylation (actin K84mel), in cytokinesis and cell proliferation as well as potential application value in allusion to actin K84mel anti-cancer drug development. Only after demethylation is carried out on the actin K84mel by the ALKBH4 protein, the NMII is capable of sliding along actin fibers. The actin K84mel is capable of suppressing the interference of the contraction of contractile rings on the cytokinesis. Through the ALKBH4 gene silencing, the expression index of the actin K84mel can be increased; and through the over-expression of the actin K84mel, the mitotic time retardation and the cytokinesis failure are caused, the cell apoptosis and the multinuclear cell generation are finally caused, and the cell proliferation and migration defects are caused and the cells finally die. The expression index of the actin K84mel can be used for developing anti-tumor drugs.

The invention discloses a preparation method of gene-recombination human thymosin beta 4. The preparation method comprises the following steps of: acquisition of genes, connection of a carrier p PIC (positive-impedance converter) 9k and human-like collagen I and human thymosin beta 4 through pichia pastoris electrotransformation, selection of multi-copy insertion recombinants, fermentation of fusion protein of the gene-recombination human thymosin beta 4 with the pichia pastoris, and purification of the gene-recombination human thymosin beta 4. According to the method, the characteristic of high expression of the human-like collagen I in the pichia pastoris is utilized to guide the stable and efficient expression of the human thymosin beta 4 in the pichia pastoris. As enterokinase cuttingsites are introduced between leading peptide of the human-like collagen I of the fusion protein and the human thymosin beta 4, the problems, caused by small molecular weight, of the human thymosin beta 4 in the process of expression and purification are solved, the expression index is increased, the purification procedure is simplified, and the extraction and purification efficiency of the product is improved. The preparation method can be used for preparing the gene-recombination human thymosin beta 4.

The invention discloses an expression system of fusion protein from human serum albumin and interleukin-1 receptor antagonist. The expression system comprises a host cell and an expression vector transferred into the same. The expression vector comprises a first expression vector with an inserted fusion protein gene and a second expression vector with an inserted protein disulfide isomerase gene.The fusion protein gene comprises the human serum albumin and the interleukin-1 receptor antagonist. The host cell is Pichia pastoris GS115. The co-expression host of PDI (protein disulfide isomerase) and IGH (immunoglobulin heavy) is established, and expression index of the IGH is evidently increased. The PDI is expressed intracellularly, the IGH secretory expression is subjected to extracellular secretory expression, and accordingly no newly generated other proteins occur when concentration of the IGH in collected medium supernate increases.

The invention provides a student expression ability evaluation method and device, and the method comprises the steps: obtaining the audio data and video data of a target classroom; obtaining audio features of the target student according to the audio data, wherein the audio features at least comprise one audio index; obtaining expression features of the target student according to the video data,wherein the expression features at least comprise one expression index; respectively determining the comprehensive weight of each audio index and the comprehensive weight of each expression index; calculating an expression ability score of the target student in the target classroom according to the value of each audio index, the value of the expression index and the comprehensive weight of each audio index and the expression index; and calculating a comprehensive expression ability score of the target student in the preset period according to the expression ability scores of the target studentin different time periods in the preset period and the time weights of the target student in different time periods in the preset period. The comprehensive expression ability score of the target student, which is calculated by implementing the method, is more accurate.

The invention provides an eucalyptus PGEF12 gene. A cDNA sequence of the eucalyptus PGEF12 gene is characterized in that the cDNA sequence has a DNA sequence shown by SEQ ID NO. 1 or a code of the eucalyptus PGEF12 gene has a polypeptide of an amino acid sequence shown by SEQ ID NO. 2. The invention further provides a plant expression vector, which comprises the eucalyptus PGEF12 gene. The invention further provides the above gene, the plant expression vector or an application of a host cell the gene including the plant expression vector in aspects of stimulating plant vegetative growth and increasing plant biomass; and the application is specifically as follows: the gene and / or the plant expression vector is transferred into a plant; or the plant is infected by the host cell. Through increasing an expression index of the PGEF12 in the plant, the number of leaves of the plant as well as the diameter of the plant can be increased, the growth of a root can be promoted and the biomass can be increased. The technical scheme provided by the invention can be used for increasing yields of forests, vegetables and commercial crops.