Gene for coding recombinant human TNFR-Fc fusion protein and application of gene

A fusion protein and coding technology, applied in the protein field, can solve the problems of low cost and high price, and achieve the effects of high affinity, simple operation and prolonging cell growth time.

Active Publication Date: 2013-02-06
JINAN UNIVERSITY +1
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the price is still relatively high, so less costly production methods still need to be obtained

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for coding recombinant human TNFR-Fc fusion protein and application of gene
  • Gene for coding recombinant human TNFR-Fc fusion protein and application of gene
  • Gene for coding recombinant human TNFR-Fc fusion protein and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] According to the preference of codons used by CHO mammalian cells, the present invention has known the amino acid sequence of TNFR-FC protein, and designed 4 new gene sequences encoding TNFR-FC protein as follows:

[0037] Sequence 1:

[0038] ATGGCCCCCGTGGCCGTGTGGGCTGCCCTGGCCGTGGGACTGGAACTG TGGGCTGCTGCCCACGCC CTCCCGGCCCAGGTCGCCTTCACCCCGTACGCCCCGGAGCCAGGCTCCACCTGCAGGCTCAGAGAGTACTACGACCAGACCGCCCAGATGTGCTGCTCCAAGTGCTCTCCAGGCCAGCATGCCAAGGTCTTCTGCACCAAGACCTCGGACACCGTCTGCGACTCGTGCGAGGACTCGACCTACACCCAGCTCTGGAACTGGGTCCCGGAGTGCCTCTCGTGTGGCTCGAGGTGCTCTTCGGACCAGGTGGAGACCCAGGCCTGCACCAGAGAGCAGAACAGGATCTGCACCTGCAGACCGGGCTGGTACTGCGCCCTCTCGAAGCAGGAAGGCTGCAGGCTGTGCGCCCCACTCAGGAAGTGCAGGCCGGGCTTCGGCGTCGCCAGACCGGGCACCGAGACCTCCGACGTCGTCTGCAAGCCCTGCGCCCCAGGCACCTTCTCGAACACCACCTCGTCCACCGACATCTGCAGGCCCCACCAGATCTGCAACGTCGTCGCTATCCCGGGCAATGCCTCGATGGACGCCGTCTGCACCTCGACCTCGCCGACCAGATCGATGGCCCCAGGCGCCGTCCACCTGCCGCAGCCGGTCTCCACCAGGTCGCAGCACACCCAGCCCACCCCAGAGCCTAGCACCGCCCCCTCTACCAGCTTCCTGCTGCCCATGG...

Embodiment 2

[0054] Transfection and expression of fusion genes in Chinese hamster ovary cells (CHO cells, Cell Resource Center, Shanghai Institute of Biological Sciences, Chinese Academy of Sciences).

[0055] The clones pIRESneo3-TNFR-Fc-1, pIRESneo3-TNFR-Fc-2, pIRESneo3-TNFR-Fc-3 and pIRESneo3-TNFR-Fc-4 were respectively inoculated in liquid LB medium containing 100 μg / ml ampicillin, 37 Cultivate overnight at ℃, and extract plasmid DNA with μltrapure Plasmid Purification Kit (QIAGEN).

[0056] CHO cells were transfected with liposomes, and the transfection kit was purchased from Invitrogen. During transfection, take 100 μg of the purified pIRESneo3-TNFR-Fc-1, pIRESneo3-TNFR-Fc-2, pIRESneo3-TNFR-Fc-3 and pIRESneo3-TNFR-Fc-4 plasmids as DNA samples to transfect CHO cells , the transfection procedure was carried out according to the manufacturer's instructions.

[0057] After transfection, the CHO cells were continuously treated with puromycin (PM) for 3 months, the concentration was fro...

Embodiment 3

[0072] Fermentation culture in 55L disposable bioreactor

[0073] (1) Take the recombinant CHO cell line constructed and screened (the clone No. 25 of the recombinant TNFR-Fc-2 gene), and use about 5×10 5 The cells / ml were inoculated in proCHO5 medium containing 4mM glutamine, 0.1mM hypoxanthine and 0.016mM thymine, using 50ml Tubespin, the culture volume was 10ml, the culture temperature was 37°C, and the rotation speed was 180rpm. In the process of cell subculture and expansion, the culture is enlarged step by step. After cell expansion in 250ml, 500ml, 1000ml and 5000ml shake flasks, when the cell density reaches 4×10 6 When cells / ml, the transfer adopts 55L disposable bioreactor bags for batch culture, and the culture volume is 32L. During fermentation and growth, according to the growth law of recombinant CHO cells, cultivate them according to conventional methods, initially adjust the speed at 90rpm / min, keep the temperature at 37°C, adjust the air flow at 10L / h, contro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene for coding a recombinant human TNFR-Fc fusion protein and an application of the gene. The gene for coding the recombinant human TNFR-Fc fusion protein as shown in SEQ ID NO.1 is obtained by optimized screening of codons. The gene has high expression index in a CHO (Chinese Hamster Ovary) cell, and the expressed protein has high affinity with TNFR. The gene is transferred into the CHO cell to obtain a cell for expressing the recombinant human TNFR-Fc fusion protein. The CHO cell into which the gene is transferred is fermented by using a disposable reactor, the operation is simple, and the obtained protein quantity is higher in comparison with the conventional fermentation tank; and especially after a supplemented medium is added, the cell growth time can be prolonged, the expression level can be increased, the production cost can be reduced, and a high-purity target protein can be obtained.

Description

technical field [0001] The invention relates to a protein, in particular to a gene encoding recombinant human TNFR-Fc fusion protein and its application. Background technique [0002] Human tumor necrosis factor (TNF-α) is a cytokine produced by activated monocytes / macrophages and has various biological effects. TNF-α can induce tumor cell necrosis or apoptosis, and is also the main cytokine that mediates inflammatory response. Studies have found that the content of TNF-α in the serum of patients with rheumatoid arthritis far exceeds the level of normal people, and its possible pathogenic mechanism has also been gradually discovered. The increase of TNF content in the joint cavity will have two effects: on the one hand, TNF-α binds to the receptors of joint synoviocytes, causing direct damage to the cells; on the other hand, TNF-α can recruit immune effector cells Accumulated here, more cytokines are secreted, resulting in a stronger and longer-lasting autoimmune response....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/62C12N15/85C12N15/66C12N5/10C12P21/02
Inventor熊盛谢秋玲洪岸黄亚东陈志南陈慧萍
OwnerJINAN UNIVERSITY