Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof

A methicillin-resistant and recombinant protein technology, applied in the field of biotechnology and pharmaceuticals, can solve the problems of transient immune response and inability to cause immunity, and achieve high expression, maintain spatial conformation and immunogenicity, and mild purification conditions Effect

Inactive Publication Date: 2012-09-19
CHONGQING YUANLUN BIOTECH +1
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the many limitations of subunit vaccines, for example, the immune response caused by them in the recipient is mostly transient and cannot cause long-term effective immunity. question

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof
  • Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof
  • Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1: Cloning of Methicillin-resistant Staphylococcus aureus iron ion surface determinant protein IsdB active fragment IsdB2

[0068] 1. Firstly, according to the full-length gene sequence of MRSA-252IsdB protein, use bioinformatics software for structural analysis. For the analysis results, see the attached Figure 6-9 , so as to determine the IsdB2 target gene fragment that needs to be amplified.

[0069] 2. According to the analysis results, the PCR method is used to amplify the IsdB2 target gene fragment from the MRSA-252 genome, and the amplification steps are as follows:

[0070] 1) Design the PCR primers as follows, which are SEQ ID NO: 5-6 (the base sequence of the restriction site is underlined)

[0071] isdB2-F: SEQ ID NO: 5

[0072] 5'-CGC GGATCC ATGAATGGCGAAGCAAAAGCAGC-3'

[0073] BamH Ⅰ

[0074] isdB2-R: SEQ ID NO: 6

[0075] 5'-TTTTCCTTTT GCGGCCGC CTATGTCATATCTTTTATTAGATTCTTC

[0076] -3'Not Ⅰ

[0077] In this embodiment, the nucleotide seq...

Embodiment 2

[0106] Example 2: MRSA-252 IsdB subunit active fragment IsdB2 induced expression, purification and expression form identification in prokaryotic expression system-Escherichia coli

[0107] 1. Induced expression of target protein

[0108] 1) Take 100 μL of the pGEX-6P-2-IsdB2 / XL-1blue bacterial solution that was correctly identified by double enzyme digestion and add it to 10 mL of Amp-resistant TB medium, cultivate overnight at 80 rpm at 37°C, take 400 μL of the overnight cultured bacterial solution and add 20 mL of Amp In the resistant TB medium (the rest of the bacterial solution is stored in a 4°C refrigerator for later use), culture at 37°C for 2~3h, rotate at 200rpm, and reactivate to OD600 of 0.6~0.8, add 40μL of IPTG to make the final concentration 200 μM, then placed on a shaking table to induce expression at 30°C for 3h, 25°C for 5h, and overnight induction at 18°C, 16°C, and 12°C.

[0109] 2) Take out the bacterial solution after induced expression, centrifuge at 60...

Embodiment 3

[0116] Embodiment 3: Preparation of IsdB2 antigen

[0117] 1. Scale up culture to obtain protein

[0118] Take 400 μL of the spare pGEX-6P-2-isdB2 / XL-1blue bacterial solution stored in the refrigerator at 4°C and add it to 20mL TB medium containing Amp resistance for one activation. Add the primary activated bacterial solution to 400mL TB medium containing Amp resistance for secondary activation, culture at 37°C for 3~4h until OD600 is 0.8, add 80μl IPTG (final concentration is 200uM) and place in a shaker at 16°C After overnight induction, centrifuge at 6000rpm for 15min to collect the bacteria, add 20mL of lysis buffer to resuspend the bacteria, then ultrasonically lyse the bacteria for 3min (200V), collect the supernatant and 800μL Glutathione Sepharose 4B gel for binding to GST fusion protein Beads (beads) binding treatment; then SDS-PAGE gel electrophoresis, the results are shown in Figure 4 , it can be seen that the target protein is expressed in large quantities in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant protein of active segment IsdB2 of decision protein IsdB on the surface of methicillin-resistant staphylococcus aureus iron ion, wherein the amino acid sequence of the recombinant protein is SEQ ID No: 3 or the sequence which has the same or similar function as the SEQ ID No: 3 obtained by adding or deleting a plurality of amino acids at the amino terminal and / or the carboxyl terminal of the SEQ ID No: 3. The invention further discloses a method for preparing the recombinant protein by building the expression vector of the recombinant protein and transforming the host bacteria, and the use of the recombinant protein in the aspect of preparing the subunit vaccine and the related assay kits resisting the methicillin-resistant staphylococcus aureus. By adopting the gene engineering technology, in the invention, the truncated protective antigens component IsdB2 is expressed by cloning through the protein expressing, thereby being high in expression index, convenient to separate and purify, and high-efficiency and safe. Due to the gene engineering, the recombinant polyvaccine has good immune protective effect on resisting the MRSA (methicillin-resistant staphylococcus aureus) infection.

Description

technical field [0001] The invention belongs to the field of biotechnology and pharmacy, and relates to a methicillin-resistant Staphylococcus aureus iron ion surface determinant protein IsdB active fragment IsdB2 recombinant protein, a preparation method and application thereof. Background technique [0002] Methicillin-resistant Staphylococcus aureus refers to Staphylococcus aureus resistant to oxazole penicillins such as methicillin, oxacillin and flucloxacillin. Gram-positive bacteria in the perineum, perineum, and intestinal tract usually cause skin and soft tissue infections, bacteremia, and metastatic complications such as pneumonia, endocarditis, septic arthritis, and osteomyelitis. Since it was first discovered by British scholar Jevons in 1961, it has become one of the pathogenic bacteria with the highest infection rate in ICU wards, burns, and war wounds in the world. The local infection caused by it lasts for a long time, and the mortality rate of systemic infect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/31C12N15/31C12N15/63C12N15/70C12N1/21A61K39/085A61P31/04G01N33/68C12R1/445C12R1/19
Inventor曾浩蔡昌芝邹全明卢陆童文德冯强
OwnerCHONGQING YUANLUN BIOTECH