Kit for detecting relative expression index of leukemia BCR/ABL (m-bcr) fusion gene
A technology of relative expression and fusion gene, which is applied in the field of kits for detecting the relative expression of BCR/ABL (m-bcr) fusion genes in leukemia, can solve the problems of high cost, inferior specificity, etc. The effect of reducing detection cost and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] The kit for detecting the relative expression of leukemia BCR / ABL (m-bcr) fusion gene of the present invention comprises:
[0023] Red blood cell lysate;
[0024] TRIzol;
[0025] Chloroform;
[0026] Anhydrous ethanol;
[0027] ReverTra Ace qPCR RT Kit (TOYOBO);
[0028] Detection system PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×), BCR / ABL (m-bcr) upstream and downstream primers 0.8uM each, BCR / ABL (m-bcr) probe 0.4uM; abl upstream and downstream primers each 0.8uM, abl-probe (probe) 0.4uM; where:
[0029] m-bcr-F: GGCGCCTTCCATGGAGAC
[0030] m-bcr-R: TCCTTGGAGTTCCAACGA
[0031] m-bcr-Probe: TTTGAGCCTCAGGGTCTGAGTGAA
[0032] abl-F: GCCGTGAAGACCTTGAAGGAG
[0033] abl-R: ATGATATAGAACGGGGGCTC
[0034] abl-Probe: FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA.
[0035] Positive control substance: respectively containing BCR / ABL (m-bcr) genome solution;
[0036] Negative control substance: no BCR / ABL (m-bcr) genome solution.
Embodiment 2
[0038] The using method of kit of the present invention:
[0039] (1) Extract tissue RNA from blood: add 1ml of erythrocyte lysate to a clean 1.5ml centrifuge tube, take 0.5ml of anticoagulated blood and mix well. Let stand at room temperature for 10 minutes; centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, and pipette repeatedly until sedimentation Dissolve completely, let stand at room temperature for 5 minutes; add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm 4°C for 10 minutes, absorb the supernatant layer and transfer to another new centrifuge tube; add an equal volume of isopropanol, mix well up and down, stand at room temperature Centrifuge at 14000rpm at 4°C for 10min, discard the supernatant, add 1ml of 75% ethanol, wash the tube wall upside down gently; ...
Embodiment 3
[0049] Using the nucleic acid detection kit of the present invention to detect clinical specimens
[0050] Acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML) and a small number of chronic myeloid leukemia (CML) patients' anticoagulant blood samples sent for inspection were totally 50 cases, and genomic RNA was extracted and reagents were prepared according to the method described in Example 2 and detect.
[0051] Add 2ul of each sample to the detection system PCR reaction solution. At the same time, make a standard curve of positive, negative, blank control, and internal reference gene / target gene. A 96-well fluorescent PCR instrument can detect 38 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is only 100 minutes.
[0052] The experimental results are compared with the results reported by the special inspection laboratory to determine the accuracy of the sample detection. ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap