Kit for detecting relative expression index of leukemia BCR/ABL (m-bcr) fusion gene

Abstract

The invention discloses a kit for detecting a relative expression index of a leukemia BCR / ABL (m-bcr) fusion gene. The kit comprises a red blood cell lysis solution, TRIzol, chloroform, absolute ethanol, ReverTraAceqPCRRTKit, a detection system PCR (Polymerase Chain Reaction) reaction solution, a positive control sample and a negative control sample, and is characterized in that the detection system PCR reaction solution comprises THUNDERBIRDqPCRMIX, upstream and downstream primers m-bcr-F and m-bcr-R and a probe m-bcr-Probe for detecting target genes, and primers ab1-F and ab1-R and a probe ab1-Probe for detecting internal reference genes Ab1, wherein the m-bcr-F is GGCGCCTTCCATGGAGAC, the m-bcr-R is TCCTTGGAGTTCCAACGA, the m-bcr-Probe is TTTGAGCCTCAGGGTCTGAGTGAA, the ab1-F is GCCGTGAAGACCTTGAAGGAG, the ab1-R is ATGATATAGAACGGGGGCTC, and the ab1-Probe is FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA.

Description

technical field

[0001] The invention belongs to the field of life science and biotechnology, in particular to a gene detection kit, which can detect human acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML) and a small number of chronic myeloid Detection of the expression level of BCR / ABL (m-bcr) fusion gene in patients with cellular leukemia (CML) can effectively save detection time and improve detection accuracy. Background technique

[0002] Leukemia is a kind of clonal malignant disease with abnormal hematopoietic stem cells. The leukemia cells in its clones lose the ability to further differentiate and mature and stagnate at different stages of cell development. In the bone marrow and other hematopoietic tissues, a large number of leukemia cells proliferate and accumulate and infiltrate other organs and tissues, and at the same time inhibit normal hematopoiesis. The clinical manifestations are anemia, bleeding, infection and infiltration of various organs....

Images