Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for rapidly screening hybrid strains of straw mushroom by using molecular marker

A technology of hybrid strains and molecular markers, which is applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the restrictions on the development of cross-breeding of straw mushrooms, the lack of methods for screening hybrid strains, and the absence of locks in straw mushroom hyphae. Problems such as combination of shape and shape, achieving good application prospects, speeding up research and development work, and short detection time

Inactive Publication Date: 2014-03-12
SHANGHAI ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In classical genetic studies, straw mushroom is the only basidiomycete that is identified as belonging to the primary homophyletic reproduction mode among edible fungi, but there are still many controversies about the genetic research of straw mushroom, especially the research on the reproduction mode. The lack of basic theoretical research has restricted the development of straw mushroom hybrid breeding, and brought many difficulties to the selection and breeding of new varieties of straw mushroom, thus greatly limiting the development of straw mushroom cultivation industry.
[0004] The hyphae of variola volvacea do not have lock-like associations, and there is a lack of methods for screening hybrid strains. Therefore, it is urgent to develop effective methods for screening hybrid strains of volvox volvulus, in order to facilitate the breeding of new varieties of varifolia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly screening hybrid strains of straw mushroom by using molecular marker
  • Method for rapidly screening hybrid strains of straw mushroom by using molecular marker
  • Method for rapidly screening hybrid strains of straw mushroom by using molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] (1) Primer synthesis

[0029] The specific primers designed for the gene sequence of the mating type A site of the monokaryotic strain A1 of volvulus volvulus are A1F:

[0030] AGGGCATTCCAACCTATTCGCTTTC;

[0031] A1R: AATGTGAACAGTTTGAGCGGAGT.

[0032] (2) Straw mushroom mycelium culture

[0033] The monosporus strain of volvoxin was inoculated on PDA plate medium and cultured at 32°C; the composition of PDA plate medium was: 200g of sliced ​​potato juice filtrate was added, 20g of glucose and 20g of agar were added, and the volume was made up to 1000mL with water.

[0034] (3) Determine the mating genotype of monokaryotic strains

[0035] Pick the hyphae of V. volvulus, and use the Phire Plant Direct PCR Kit (FINNZYMES) kit to directly detect the genotype of the mating type of the strain.

[0036] (4) Straw mushroom hybridization test

[0037] Inoculate the monospore strains of the mating type genotype on the PDA plate medium respectively, culture at 32°C for 5 day...

Embodiment 2

[0043] (1) Primer synthesis

[0044] The specific primer designed for the gene sequence of the mating type A locus of the monokaryotic strain A2 of volvulus is A2F: CACTATCTCCTTGCGTTTGTTATG;

[0045] A2R: ATAACCAAACGCCAGAAACACTA.

[0046] (2) Straw mushroom mycelium culture

[0047] The monosporus strain of volvoxin was inoculated on PDA plate medium and cultured at 32°C; the composition of PDA plate medium was: 200g of sliced ​​potato juice filtrate was added, 20g of glucose and 20g of agar were added, and the volume was made up to 1000mL with water.

[0048](3) Determine the mating genotype of monokaryotic strains

[0049] Pick the hyphae of V. volvulus, and use the Phire Plant Direct PCR Kit (FINNZYMES) kit to directly detect the genotype of the mating type of the strain.

[0050] (4) Straw mushroom hybridization test

[0051] Inoculate the monospore strains of the mating type genotype on the PDA plate medium respectively, culture at 32°C for 5 days, punch holes in the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for rapidly screening hybrid strains of a straw mushroom by using a molecular marker. The method comprises the following steps: (1) synthesis of a primer; (2) mycelium culture of the straw mushroom; (3) determination of the type of a mating type gene of the mononuclear strain; (4) hybridization test of the straw mushroom; and (5) PCR amplification and determination. Compared with methods like conventional morphological detection, antagonism test and fruiting test, the method provided by the invention has the advantages of simple and convenient operation, a short period of detection time and high accuracy; the method can use the molecular marker of the mating type gene to screen the hybrid strains, which is beneficial for crossbreeding of the straw mushroom, so research and development on a novel variety of the straw mushroom are accelerated, and the method has a good application prospect.

Description

technical field [0001] The invention belongs to the field of screening straw mushroom hybrid strains, in particular to a method for quickly screening straw mushroom hybrid strains with molecular markers. Background technique [0002] Straw mushroom (Volvariella volvacea) cultivation originated in China, has a cultivation history of more than 300 years so far, and is widely cultivated in southern my country. Straw mushrooms are delicious, not only rich in nutritional value, but also have an important role in health care, and are deeply loved by consumers. Straw mushroom is a high-temperature cultivated edible fungus. Compared with other edible fungi, its remarkable feature is that its growth rate is extremely fast. It usually only takes 2 weeks from sowing to harvesting. Its annual output has always ranked first in my country's edible fungi industry. Top ten. [0003] In classical genetic studies, straw mushroom is the only basidiomycete that is identified as belonging to th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 汪虹陈明杰鲍大鹏冯爱萍薛承琴
Owner SHANGHAI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More