Unlock instant, AI-driven research and patent intelligence for your innovation.

Artificially synthesized aphid-resistant gene ASGNA (artificial synthetic galanthus nivalis agglutinin), as well as synthesizing method and application thereof

A technology of artificial synthesis and synthetic method, applied in application, genetic engineering, DNA preparation, etc., can solve the problems of low gene expression and inability to achieve anti-aphid effect, etc.

Inactive Publication Date: 2013-06-12
SHAANXI NORMAL UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, although the plant lectin gene derived from snowdrops has good aphid resistance, the gene is highly expressed in monocotyledonous plants, which is suitable for the research of transgenic insect resistance in monocotyledonous plants, while natural GNA is transferred into dicotyledonous plants. Among them, the expression level of this gene is low, and the expected anti-aphid effect cannot be achieved. Therefore, it is necessary to modify the natural GNA to make it suitable for the transgenic application of dicotyledonous plants such as Arabidopsis and cotton.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificially synthesized aphid-resistant gene ASGNA (artificial synthetic galanthus nivalis agglutinin), as well as synthesizing method and application thereof
  • Artificially synthesized aphid-resistant gene ASGNA (artificial synthetic galanthus nivalis agglutinin), as well as synthesizing method and application thereof
  • Artificially synthesized aphid-resistant gene ASGNA (artificial synthetic galanthus nivalis agglutinin), as well as synthesizing method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0092] The full-length 512bp anti-aphid gene ASGNA contains a 5' untranslated region of 17 nucleotides (1 nucleotide to 17 nucleotides), a 21 nucleotide 3' untranslated region (492 nucleotides Nucleotide-512 nucleotides) and a 474bp open reading frame (18 nucleotides-491 nucleotides), the nucleotide sequence is as follows:

[0093] CAACTACAAGTTACAAATGGCTAAGGCAAGTCTCCTCATTTTGGCCG

[0094] CCATTCTTCCTTGGTGTCATCACACCATCTTGCCTGAGTGACAATATTTT

[0095] TGTACTCCGGTGAGACTCTCTCTACTGGGGAATTTCTCAACTACGGAA

[0096] GTTTCGTTTTTATCATGCAAGAGGACTGCAATCTGGTCTTGTACGACG

[0097] TGGACAAGCCAATCTGGGCAACAAACACAGGTGGTCTCTCCCGTAGCT

[0098] GCTTCCTCAGCATGCAGACTGATGGGAACCTCGTGGTGTACAACCCAT

[0099] CTAACAAACCAATTTGGGCAAGCAACACTGGAGGCCAAAATGGGAATT

[0100] ACGTGTGCATCCTTCAGAAGGATAGGAACGTTGTGATCTACGGAACTG

[0101] ATCGTTGGGCTACTGGAACTCACACCGGACTTGTTGGAATTCCCGCAT

[0102] CTCCACCCTCAGAGAAATATCCTACTGCTGGAAAGATTAAGCTTGTGA

[0103] CTGCAAAGTAATGACCGGTGATCTTTTAACTT

[0104] The synthetic method of a...

Embodiment 2

[0190] The application of the anti-aphid gene ASGNA synthesized in embodiment 1 in the anti-aphid of dicotyledonous plants is as follows:

[0191] Transfer the expression vector pBI121-ASGNA into Agrobacterium GV3101, pick out the single clone of Agrobacterium containing the target gene on the medium containing 50mg / L kanamycin, and inoculate it in 15mL LB liquid selection medium (containing 50mg / L rifampicin, 50mg / L gentamicin, 50mg / L kanamycin), cultured at 28°C and 200 rpm for 24 hours. Inoculate 15mL of activated bacterial liquid into 1L LB liquid medium (containing 50mg / L rifampicin, 50mg / L gentamicin, 50mg / L kanamycin), and cultivate to 600nm at 28°C at 200 rpm The absorbance value is 0.8-1.0. The bacteria were collected by centrifugation and resuspended in 1.5L transformation solution. The transformation solution ratio was: 1 / 2×MS, 5% sucrose, 1×B5 organic, 0.044μmol / L6-BA, 50μl / L Silwet L-77 ( Purchased from Zhongke Ruitai Biotechnology Co., Ltd., product number: Sil...

Embodiment 3

[0195] In Example 2, the expression vector pBI121-ASGNA was transferred into Agrobacterium GV3101, and a single clone of Agrobacterium containing the gene of interest was picked on a medium containing 50 mg / L kanamycin, and inoculated in 10 mL LB liquid selection culture culture medium at 28°C at 200 rpm for 24 hours. Inoculate 15 mL of the activated bacterial liquid into 1 L of LB liquid medium, and incubate at 28°C at 200 rpm until the absorbance at 600 nm is 0.8-1.0. The cells were collected by centrifugation, resuspended in 1L of transformation solution, adjusted to 1L with distilled water, and adjusted to pH 5.8 with 0.4mol / L NaOH. Other steps are the same as in Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an artificially synthesized aphid-resistant gene ASGNA (artificial synthetic galanthus nivalis agglutinin), which comprises 5' untranslated regions of 17 nucleotides, 3' untranslated regions of 21 nucleotides, and an open reading frame with the length of 474bp. The synthesizing method comprises the following steps that: in a galanthus nivalis agglutinin gene sequence, A on the 122th site is changed into T, G on the 290th site is changed into T, G on the 299th site is changed into A, A on the 350th site is changed into T, T on the 365th site is changed into C, G on the 434th site is changed into T, A on the 470th site is changed into T, and G on the 482th site is changed into T, so that a nucleotide sequence of the aphid-resistant gene ASGNA can be obtained. The invention also provides application of artificial synthetic aphid-resistant gene ASGNA in an aphid-resistant transgenic plant by transforming arabidopsis. The constructed expression vector connected with the aphid-resistant ASGNA is transformed and expressed in Arabidopsis, and the results of aphid growing and avoidance experiments on transgenic arabidopsis indicate that the average inhibition rate to aphid is 44 percent.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to an artificially synthesized anti-aphid gene-ASGNA sequence and an encoded amino acid sequence. Background technique [0002] Some piercing and chewing Homoptera pests such as aphids are one of the extremely important pests in agriculture. They feed on plant juices, which not only cause serious damage to crops, but also undertake the excellent transmission of plant viruses. medium. For example, from 2000 to 2003, a severe plant virus broke out in Henan Province of my country, and many crops were attacked, causing huge economic losses. Among them, aphids played a leading role in the spread of the virus. Although the use of chemical pesticides can quickly kill pests in a short period of time, it has also produced a series of problems, such as polluting the environment, destroying ecological balance, killing natural enemies of aphids, and endangering hu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/10A01H5/00
Inventor 俞嘉宁常淑芬田莉莉
Owner SHAANXI NORMAL UNIV