Artificially synthesized aphid-resistant gene ASGNA (artificial synthetic galanthus nivalis agglutinin), as well as synthesizing method and application thereof
A technology of artificial synthesis and synthetic method, applied in application, genetic engineering, DNA preparation, etc., can solve the problems of low gene expression and inability to achieve anti-aphid effect, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0092] The full-length 512bp anti-aphid gene ASGNA contains a 5' untranslated region of 17 nucleotides (1 nucleotide to 17 nucleotides), a 21 nucleotide 3' untranslated region (492 nucleotides Nucleotide-512 nucleotides) and a 474bp open reading frame (18 nucleotides-491 nucleotides), the nucleotide sequence is as follows:
[0093] CAACTACAAGTTACAAATGGCTAAGGCAAGTCTCCTCATTTTGGCCG
[0094] CCATTCTTCCTTGGTGTCATCACACCATCTTGCCTGAGTGACAATATTTT
[0095] TGTACTCCGGTGAGACTCTCTCTACTGGGGAATTTCTCAACTACGGAA
[0096] GTTTCGTTTTTATCATGCAAGAGGACTGCAATCTGGTCTTGTACGACG
[0097] TGGACAAGCCAATCTGGGCAACAAACACAGGTGGTCTCTCCCGTAGCT
[0098] GCTTCCTCAGCATGCAGACTGATGGGAACCTCGTGGTGTACAACCCAT
[0099] CTAACAAACCAATTTGGGCAAGCAACACTGGAGGCCAAAATGGGAATT
[0100] ACGTGTGCATCCTTCAGAAGGATAGGAACGTTGTGATCTACGGAACTG
[0101] ATCGTTGGGCTACTGGAACTCACACCGGACTTGTTGGAATTCCCGCAT
[0102] CTCCACCCTCAGAGAAATATCCTACTGCTGGAAAGATTAAGCTTGTGA
[0103] CTGCAAAGTAATGACCGGTGATCTTTTAACTT
[0104] The synthetic method of a...
Embodiment 2
[0190] The application of the anti-aphid gene ASGNA synthesized in embodiment 1 in the anti-aphid of dicotyledonous plants is as follows:
[0191] Transfer the expression vector pBI121-ASGNA into Agrobacterium GV3101, pick out the single clone of Agrobacterium containing the target gene on the medium containing 50mg / L kanamycin, and inoculate it in 15mL LB liquid selection medium (containing 50mg / L rifampicin, 50mg / L gentamicin, 50mg / L kanamycin), cultured at 28°C and 200 rpm for 24 hours. Inoculate 15mL of activated bacterial liquid into 1L LB liquid medium (containing 50mg / L rifampicin, 50mg / L gentamicin, 50mg / L kanamycin), and cultivate to 600nm at 28°C at 200 rpm The absorbance value is 0.8-1.0. The bacteria were collected by centrifugation and resuspended in 1.5L transformation solution. The transformation solution ratio was: 1 / 2×MS, 5% sucrose, 1×B5 organic, 0.044μmol / L6-BA, 50μl / L Silwet L-77 ( Purchased from Zhongke Ruitai Biotechnology Co., Ltd., product number: Sil...
Embodiment 3
[0195] In Example 2, the expression vector pBI121-ASGNA was transferred into Agrobacterium GV3101, and a single clone of Agrobacterium containing the gene of interest was picked on a medium containing 50 mg / L kanamycin, and inoculated in 10 mL LB liquid selection culture culture medium at 28°C at 200 rpm for 24 hours. Inoculate 15 mL of the activated bacterial liquid into 1 L of LB liquid medium, and incubate at 28°C at 200 rpm until the absorbance at 600 nm is 0.8-1.0. The cells were collected by centrifugation, resuspended in 1L of transformation solution, adjusted to 1L with distilled water, and adjusted to pH 5.8 with 0.4mol / L NaOH. Other steps are the same as in Example 2.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 