RNA interference targets for hepatitis b virus (HBV) infection treatment

An RNA interference and target technology, which can be used in DNA/RNA fragments, gene therapy, antiviral agents, etc., and can solve problems such as differences in inhibition efficiency

Inactive Publication Date: 2013-09-04
XIAMEN UNIV +1
View PDF2 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, not all RNAi targets that meet the conventional design requirements can effectively inhibit the expression of target genes, and the inhibition efficiency varies among different targets

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNA interference targets for hepatitis b virus (HBV) infection treatment
  • RNA interference targets for hepatitis b virus (HBV) infection treatment
  • RNA interference targets for hepatitis b virus (HBV) infection treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0138] Example 1. Design and Construction of siRNA Expression Vector Plasmids Targeting HBV

[0139] The design of the RNA interference target sequence targeting HBV: take the HBV reference sequence as the target sequence, select a well-conserved region to walk and design the siRNA sequence; perform a BLAST search on the siRNA sequence obtained from the primary selection in GenBank, select and non- The target sequence has 3 or more bases different sequences as candidate sequences.

[0140] Construction of siRNA expression plasmid: In this example, the pSUPER vector (Cat.NoVEC-PBS-0001 / 0002 of oligoengine company) was used as an example to construct an siRNA expression vector. For the specific construction process, please refer to the company's pSUPER vector experiment guide (www. .oligoengine.com), the construction brief process can be seen schematically figure 1 . Primers with RNA interference sequences were synthesized, and the complementary primers were annealed and ligat...

Embodiment 2

[0142] Example 2. Co-transfection experiment screening to obtain RNA interference targets that can inhibit HBV

[0143] pN31-N10 plasmid (this plasmid contains about 1.4 times the HBV genome (GenBank accession number: AY707087). The construction method is briefly described as follows: Mammalian cell expression vector plasmid pCDNA3.1(+) (Invitrogen Cat.NoV790-20) with SpeI After digestion, the vector was recovered and self-ligated to obtain plasmid pN31. The primer pair of N1f (ACTAGTGGATCCTTCGCGGGACGTCC) / N1r (GAATTCCACTGCATGGCCTGAG), N2f (GAATTCCACTGCCTTCCACC) / N2r (GATATCCACATTGTGTAAATGG), N3f (GATATCCTGCCTTAATGCCTTTG) / N3r (BGGCCCACAATT3GTTGACACC) was used respectively PCR amplification was carried out, and the products were respectively cloned into T vectors to obtain pTN1, pTN2, and pTN3. The fragment obtained after pTN3 was digested with EcoRV and ApaI was ligated with the carrier recovered after pN31 was digested with EcoRV and ApaI to obtain pN31-N3. With SpeI and The fr...

Embodiment 3

[0190] Example 3. Construction of recombinant viral expression vector expressing siRNA

[0191] We take the construction of a recombinant lentiviral expression vector that can express siRNA targeting siHBV7 and siHBV12 as an example.

[0192] Expression vector: In this example, the expression vector pDEST-MR of the lentiviral system we used (patent application number: 200510112917.1; publication number: CN1948475) contains an expression cassette that can be used to express siRNA controlled by the H1 promoter.

[0193] The construction method of expression vector pDEST-siHBV7, pDEST-siHBV12:

[0194] Synthesize siHBV7 and siHBV12 gene fragments respectively (the RNA interference target sequences siHBV7 (SEQ ID NO: 7) and siHBV12 (SEQ ID NO: 12) shown in Example 2 are included here as examples, but other RNAs provided by the present invention can also be included Interfering with the target sequence), add an AgeI site to the 5' end of the fragment, and a SmaI site to the 3' end...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to 42 different hepatitis b virus (HBV)-targeting RNA interference targets for HBV infection treatment. The RNA interference targets can be used for preparation of a drug for HBV infection treatment. The invention provides recombinant expression vectors for expression of HBV-targeting siRNA and / or miRNA and / or ribozyme and / or antisense oligonucleotide. The invention relates to cells which can inhibit HBV gene expression and can express and / or be introduced with the siRNA and / or the miRNA and / or the ribozyme and / or the antisense oligonucleotide and / or a drug obtained according to the RNA interference targets.

Description

[0001] This application is a divisional application of the application with the same title filed on June 13, 2008 and with application number 200810110686.4. technical field [0002] The present invention relates generally to the fields of molecular biology, cell biology and gene therapy. More specifically, the present invention relates to 42 targets of RNA interference (RNAi) that can be used in the treatment of hepatitis B virus infection, as well as recombinant expression vectors using these targets and the recombinant expression vectors that can be used in hepatitis B obtained in various ways using these targets. Drugs and methods for the treatment of hepatitis virus infection. Background technique [0003] Hepatitis B virus (HepatitisBvirus) infection is one of the most important public health problems in the world. Related diseases caused by HBV infection include acute or chronic hepatitis B, and liver cirrhosis (HC) and hepatocellular carcinoma (HCC) caused by the fu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/63C12N15/113C12N15/85C12N5/10A61K48/00A61P31/20
Inventor 程通张雅丽蔡毅君苗季张军夏宁邵
Owner XIAMEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap