RNA interference targets for hepatitis b virus (HBV) infection treatment
An RNA interference and target technology, which can be used in DNA/RNA fragments, gene therapy, antiviral agents, etc., and can solve problems such as differences in inhibition efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0138] Example 1. Design and Construction of siRNA Expression Vector Plasmids Targeting HBV
[0139] The design of the RNA interference target sequence targeting HBV: take the HBV reference sequence as the target sequence, select a well-conserved region to walk and design the siRNA sequence; perform a BLAST search on the siRNA sequence obtained from the primary selection in GenBank, select and non- The target sequence has 3 or more bases different sequences as candidate sequences.
[0140] Construction of siRNA expression plasmid: In this example, the pSUPER vector (Cat.NoVEC-PBS-0001 / 0002 of oligoengine company) was used as an example to construct an siRNA expression vector. For the specific construction process, please refer to the company's pSUPER vector experiment guide (www. .oligoengine.com), the construction brief process can be seen schematically figure 1 . Primers with RNA interference sequences were synthesized, and the complementary primers were annealed and ligat...
Embodiment 2
[0142] Example 2. Co-transfection experiment screening to obtain RNA interference targets that can inhibit HBV
[0143] pN31-N10 plasmid (this plasmid contains about 1.4 times the HBV genome (GenBank accession number: AY707087). The construction method is briefly described as follows: Mammalian cell expression vector plasmid pCDNA3.1(+) (Invitrogen Cat.NoV790-20) with SpeI After digestion, the vector was recovered and self-ligated to obtain plasmid pN31. The primer pair of N1f (ACTAGTGGATCCTTCGCGGGACGTCC) / N1r (GAATTCCACTGCATGGCCTGAG), N2f (GAATTCCACTGCCTTCCACC) / N2r (GATATCCACATTGTGTAAATGG), N3f (GATATCCTGCCTTAATGCCTTTG) / N3r (BGGCCCACAATT3GTTGACACC) was used respectively PCR amplification was carried out, and the products were respectively cloned into T vectors to obtain pTN1, pTN2, and pTN3. The fragment obtained after pTN3 was digested with EcoRV and ApaI was ligated with the carrier recovered after pN31 was digested with EcoRV and ApaI to obtain pN31-N3. With SpeI and The fr...
Embodiment 3
[0190] Example 3. Construction of recombinant viral expression vector expressing siRNA
[0191] We take the construction of a recombinant lentiviral expression vector that can express siRNA targeting siHBV7 and siHBV12 as an example.
[0192] Expression vector: In this example, the expression vector pDEST-MR of the lentiviral system we used (patent application number: 200510112917.1; publication number: CN1948475) contains an expression cassette that can be used to express siRNA controlled by the H1 promoter.
[0193] The construction method of expression vector pDEST-siHBV7, pDEST-siHBV12:
[0194] Synthesize siHBV7 and siHBV12 gene fragments respectively (the RNA interference target sequences siHBV7 (SEQ ID NO: 7) and siHBV12 (SEQ ID NO: 12) shown in Example 2 are included here as examples, but other RNAs provided by the present invention can also be included Interfering with the target sequence), add an AgeI site to the 5' end of the fragment, and a SmaI site to the 3' end...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap