New strategy for achieving secretion expression of heterogeneous protein by using non-classical secretion proteins
A secretory expression and protein technology, applied in the field of secretory expression of exogenous proteins by using non-classic secretory proteins
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0029] 1. Acquisition of 6 genes, gapA, pdhA, eno, katA, yceD, yvgN
[0030] Genomic DNA of the B. subtilis168 strain was extracted according to the instructions of the Bacterial Genome Rapid Extraction Kit. Corresponding primers were designed according to the published whole genome sequence of Bacillus subtilis168, NdeI and EcoRI restriction sites were introduced into the upstream and downstream primers respectively, and the primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. Using genomic DNA as a template, the corresponding coding sequence was amplified by PCR, and the amplified product was detected by agarose gel electrophoresis, and the size was consistent with the expectation. The polymerase used for amplification is KOD plus from Toyobo (Shanghai) Biotechnology Co., Ltd. Primer sequences are as follows.
[0031] GapANdeIF:ATCAATTGC ATATG GCAGTAAAAGTCGGTATTAAC
[0032] GapAEcoRIR:CAAT GAATTC GGATCCAAGACCTTTTTTTGCGATGT
[0033] PdhANdeIF:GCGTGAAT...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
