Unlock instant, AI-driven research and patent intelligence for your innovation.

New strategy for achieving secretion expression of heterogeneous protein by using non-classical secretion proteins

A secretory expression and protein technology, applied in the field of secretory expression of exogenous proteins by using non-classic secretory proteins

Active Publication Date: 2013-09-04
JIANGNAN UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

We have tried to use different signal peptides to realize the secretory expression of BgaB, but unfortunately, BgaB cannot be secreted out of the cell through the general secretory pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New strategy for achieving secretion expression of heterogeneous protein by using non-classical secretion proteins
  • New strategy for achieving secretion expression of heterogeneous protein by using non-classical secretion proteins
  • New strategy for achieving secretion expression of heterogeneous protein by using non-classical secretion proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] 1. Acquisition of 6 genes, gapA, pdhA, eno, katA, yceD, yvgN

[0030] Genomic DNA of the B. subtilis168 strain was extracted according to the instructions of the Bacterial Genome Rapid Extraction Kit. Corresponding primers were designed according to the published whole genome sequence of Bacillus subtilis168, NdeI and EcoRI restriction sites were introduced into the upstream and downstream primers respectively, and the primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. Using genomic DNA as a template, the corresponding coding sequence was amplified by PCR, and the amplified product was detected by agarose gel electrophoresis, and the size was consistent with the expectation. The polymerase used for amplification is KOD plus from Toyobo (Shanghai) Biotechnology Co., Ltd. Primer sequences are as follows.

[0031] GapANdeIF:ATCAATTGC ATATG GCAGTAAAAGTCGGTATTAAC

[0032] GapAEcoRIR:CAAT GAATTC GGATCCAAGACCTTTTTTTGCGATGT

[0033] PdhANdeIF:GCGTGAAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel strategy for achieving secretion expression of heterogeneous protein in bacillus subtilis. Non-classical secretion proteins Eno, YceD and YvgN are taken as transport signals to achieve the secretion expression of heterogeneous protein BgaB, but under the guiding of YceD, the secretion quantity of BgaB is low. Under the condition of PdhA and KatA, all through very high quantity of fused protein in a cell is detected, activity of corresponding protein and BgaB outside the cell is not detected, and that PdhA and KatA can not achieve the secretion expression of BgaB is proved. When GapA is taken as a fused protein, fused protein inside the cell and fused protein outside the cell are both not detected, and possibly, the expression of fused protein in the cell does not exist. The experimental method provides novel possibility for secretion expression of heterogeneous protein in bacillus subtilis.

Description

technical field [0001] The present invention relates to a new strategy for secreting and expressing exogenous proteins in Bacillus subtilis. More specifically related to the non-canonical secreted proteins of Bacillus subtilis, glyceraldehyde-3-phosphate dehydrogenase GapA, pyruvate dehydrogenase PdhA, enolase Eno, catalase KatA, protein of unknown function YceD, glyoxal reduction The enzyme YvgN acts as a transport signal to achieve secretory expression of foreign proteins. Background technique [0002] Since Bacillus subtilis has no outer membrane, the secreted protein is directly released outside the cell; it has strong protein secretion ability; its genetic characteristics are clear and it is a food-grade microorganism. Therefore, in recent years, many scientists have tried to use Bacillus subtilis to secrete and express foreign proteins. There are four main protein secretion pathways in Bacillus subtilis: Sec secretion pathway, Tat secretion pathway, ABC transporter p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N15/66C12P21/02C12R1/125
Inventor 陈卫陈海琴王光强宋元达顾震南张灏陈永泉
Owner JIANGNAN UNIV