Supercharge Your Innovation With Domain-Expert AI Agents!

Gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and protein coded by gene GmCTRL2

An alfalfa, anti-penetration technology, applied in genetic engineering, DNA preparation, plant genetic improvement, etc., can solve the problems of lack of molecular markers, gene resistance spectrum, and unclear resistance mechanism in ecological areas.

Active Publication Date: 2013-10-09
LANGFANG NORMAL UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

From the perspective of the discovery and utilization of genetic resources, nearly 40 resistance genes have been discovered, and some have been located and cloned, but the resistance spectrum, adaptation ecological zone, and resistance mechanism of most genes are not clear. Some don't even have molecular markers to track
No studies have been performed on the function of cation-like transport regulator 2 in soybean

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and protein coded by gene GmCTRL2
  • Gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and protein coded by gene GmCTRL2
  • Gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and protein coded by gene GmCTRL2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0089] The embodiments of the present invention will be further described below in conjunction with the accompanying drawings, but this is not a limitation of the present invention. The scope of protection of the present invention is based on the contents of the claims. Any replacement of equivalent technical means based on the specification does not depart from this scope of protection for inventions.

[0090] The gene of this embodiment and the amino acid sequence encoded by it are as described above, and the preparation method of the gene is as follows:

[0091] The preparation method of the gene GmCTRL2 that improves the resistance to osmotic stress of alfalfa uses 5'-ATAGGT ACCGAGCTCTCAGATCCAAATAAATCATG-3' as the upstream primer S1, and 5'-CTGGGATCCCTCG AGCCTCAGCTATATATCCATTG3' as the downstream primer A1, and uses soybean plant roots, stems, and leaf tissues The cDNA synthesized by reverse transcription of the RNA was used as a template and obtained by PCR amplification....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to preparation of new genes, and particularly provides a gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and a protein coded by the gene GmCTRL2. The gene GmCTRL2 is prepared by a PCR (Polymerase Chain Reaction) amplification method with 5'-ATAGG TACCGAGCTCTCAGATCCAAATAAATCATG-3'serving as a forward primer S1, 5'-CTGGGATCCCTC GAGCCTCAGCTATATATCCATTG3' serving as a reverse primer A1, and cDNA (complementary Deoxyribose Nucleic Acid) serving as a template, wherein the cDNA is synthesized by the reverse transcription of RNA (Ribose Nucleic Acid) in root, stem and leaf organization of soybean subjected to salt stress treatment. The gene GmCTRL2 solves the problems in the prior art that plants are lack of resistance genes, and the resistant spectrum, adaptive ecological zones and resistance mechanisms and the like of most of the genes are unclear, and has the advantage that the salt tolerance and drought resistance of a transgenic callus are improved obviously by comparing with a wild type callus.

Description

technical field [0001] The invention belongs to the preparation of new genes, in particular to a gene GmCTRL2 for improving the anti-osmotic stress ability of alfalfa and the protein encoded by the preparation and utilization thereof. Background technique [0002] Adversity is one of the important factors that limit plant growth and affect yield formation. The isolation, cloning, and transformation of resistance genes have always been highly valued by scientists. From the perspective of the discovery and utilization of genetic resources, nearly 40 resistance genes have been discovered, and some have been located and cloned, but the resistance spectrum, adaptation ecological zone, and resistance mechanism of most genes are not clear. Some don't even have molecular markers to track them. Therefore, it is necessary to conduct systematic research and evaluation on existing resistance resources [1] . Studying resistance genes and expressing them in plants can help improve plan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/10C07K14/415
Inventor 孙艳香冯雪王彬贾永红
Owner LANGFANG NORMAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More