Gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and protein coded by gene GmCTRL2
An alfalfa, anti-penetration technology, applied in genetic engineering, DNA preparation, plant genetic improvement, etc., can solve the problems of lack of molecular markers, gene resistance spectrum, and unclear resistance mechanism in ecological areas.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0089] The embodiments of the present invention will be further described below in conjunction with the accompanying drawings, but this is not a limitation of the present invention. The scope of protection of the present invention is based on the contents of the claims. Any replacement of equivalent technical means based on the specification does not depart from this scope of protection for inventions.
[0090] The gene of this embodiment and the amino acid sequence encoded by it are as described above, and the preparation method of the gene is as follows:
[0091] The preparation method of the gene GmCTRL2 that improves the resistance to osmotic stress of alfalfa uses 5'-ATAGGT ACCGAGCTCTCAGATCCAAATAAATCATG-3' as the upstream primer S1, and 5'-CTGGGATCCCTCG AGCCTCAGCTATATATCCATTG3' as the downstream primer A1, and uses soybean plant roots, stems, and leaf tissues The cDNA synthesized by reverse transcription of the RNA was used as a template and obtained by PCR amplification....
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



