Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for performing molecular reactions by using immiscible intermediate fluids

An intermediate fluid and molecular reaction technology, applied in fluid controllers, laboratory containers, chemical instruments and methods, etc., can solve the problems of reducing reagent concentration, limited concentration, sequencing speed and low reaction rate, etc.

Inactive Publication Date: 2013-12-18
KONINKLJIJKE PHILIPS NV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

One reason for the low sequencing speed is the limited reaction rate when incorporating nucleotides, which is limited by the concentration of enzymes or other reactants in the reaction mixture for cost reasons
What's more, due to the need to wash the entire surface after each step of nucleotide incorporation, all reagents are often wasted
Thus, total reagent consumption is primarily proportional to read length and constitutes a major cost factor
This in turn leads to a tendency to reduce reagent concentrations as much as possible with the disadvantage of longer reaction times

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for performing molecular reactions by using immiscible intermediate fluids
  • Method for performing molecular reactions by using immiscible intermediate fluids
  • Method for performing molecular reactions by using immiscible intermediate fluids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0168] Example 1 – Effect of FC-40 on hybridization signal

[0169] To test the effect of FC-40 on the hybridization signal, two different probes, PCR12 and PCR5, were hybridized at a concentration of 1 nM.

[0170] PCR product 12 contains 114 base pairs and is a part of human chromosome, and the accession number on March 15, 2011 is No.NCBI36:12:111399702:111400602:1; the sequence is reported as follows (SEQ ID NO:1), for capture The specific binding region of the probe is underlined:

[0171] AGTTACATTGCCACAC AAGGCTGCCTGCAAAACACGGTGAATGACTTTTGGCGGATGGT GTTCCAAAGAAAACTCCC GAGTGATTGTCATGACAACGAAAGAAGTGGAGAGAGGA (SEQ ID NO: 1)

[0172] PCR product 5 comprises 108 base pairs and is part of human chromosome, and the accession number on March 15, 2011 is No.NCBI36:5:127637813:127638713:1; the sequence is reported as follows (SEQID NO:2), for the capture probe The specific binding region of the needle is underlined:

[0173] ACCAGGTGGACATTTACAGGTAAACCC CCCCAGGGTGTTGACACA...

Embodiment 2

[0191] Example 2 – Effect of FC-40 on the enzymatic end repair PRC reaction

[0192] To test the effect of FC-40 on the enzymatic end repair PRC reaction, hybridization was performed with Cp40am (synthetic oligonucleotide with amino functionality, 58 nucleotides long (Biolegio)). The sequence of Cp40am is reported as follows (SEQ ID NO:5):

[0193] Cp40am:

[0194] AGTCCTCACCCAAGCGCACGTTTTCGATTAGCTGCCCAAGTCTTCAATGCATCTTACC (SEQ ID NO: 5)

[0195] Cp40am was dissolved in PBS with 1.5M betaine and imprinted as capture probes onto Nexterion slides P (Schott) as recommended in the datasheet. A 16-well superstructure (Schott) was applied to the imprinted slides.

[0196] As40+4 (complementary probe (GCTA-) with 4 overhanging nucleotides) was dissolved in hybridization buffer (3x SSC w 0.1% SDS) to 10 nM; 50 μl of hybridization solution was introduced into the wells. Hybridization was carried out at 50°C for 30 minutes.

[0197] After washing in wash buffer (1x SSC w0.2% SDS), ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
boiling pointaaaaaaaaaa
boiling pointaaaaaaaaaa
boiling pointaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a method for performing molecular reactions in a device. The method comprises the steps of (a) introducing one or more reagent solutions and an immiscible intermediate fluid into the device, wherein the device comprises a substrate, on which chemically or biochemically recognizable entities are immobilized; (b) performing molecular reactions between the immobilized chemically or biochemically recognizable entities and the reagent solutions, or on the immobilized chemically or biochemically recognizable entities in the presence of the reagent solutions; (c) displacing the reagent solutions present on the substrate by the immiscible intermediate fluid; (d) separating the immiscible intermediate fluid and the reagent solutions, and reusing the reagent solutions and / or immiscible intermediate fluid for one or more repetitions of steps (a) to (e). The invention further relates to a device for performing the molecular reactions, comprising a reaction zone, reservoirs and liquid connections and a collection and regeneration zone wherein the immiscible intermediate fluid and the reagent solutions are separable by gravitational separation, or a redirection and distribution module, wherein the immiscible intermediate fluid and reagent solutions are separated. The invention also relates to the use of an immiscible intermediate fluid for displacing a reagent solution present in a reaction zone in a microfluidic device, as well as the use of a corresponding device for performing a sequencing reaction or a nucleic acid synthesis reaction.

Description

field of invention [0001] The present invention relates to a method for carrying out molecular reactions in a device comprising the steps of: (a) introducing one or more reagent solutions and an immiscible intermediate fluid into said device, wherein said device comprises a chemical compound immobilized thereon. or a substrate of a biochemically identifiable entity; (b) carrying out a molecular reaction between said immobilized chemically or biochemically identifiable entity and said reagent solution; or in the presence of said reagent solution on said immobilized chemically or biochemically performing a molecular reaction on an identifiable entity; (c) replacing a reagent solution present on said substrate with said immiscible intermediate fluid; (d) separating said immiscible intermediate fluid and said reagent solution; and regenerating One or more repetitions of steps (a) to (e) are performed using said reagent solution and / or immiscible intermediate fluid. The invention ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): B01L3/00C12Q1/68B01J19/00G01N35/08
CPCB01L3/502784B01L7/52B01L2200/0673B01L2200/16B01L2300/0636B01L2300/088B01L2400/0487G01N35/08C12Q1/6869
Inventor R·温贝格尔-弗里德尔P·J·范德扎格E·塞尔沃利
Owner KONINKLJIJKE PHILIPS NV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More