Primer for amplifying short-chain RNA (ribonucleic acid) and related method thereof

A short-chain, reverse primer technology, applied in biochemical equipment and methods, DNA/RNA fragments, DNA preparation, etc., can solve the problems of no relevant literature, etc., and achieve the effect of reducing synthesis cost, simple design, and low cost

Inactive Publication Date: 2014-01-15
ZHOUSHAN HOSPITAL
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] There is no relevant literature in the search of the Chinese patent literature database

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for amplifying short-chain RNA (ribonucleic acid) and related method thereof
  • Primer for amplifying short-chain RNA (ribonucleic acid) and related method thereof
  • Primer for amplifying short-chain RNA (ribonucleic acid) and related method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: Stem-loop RT primer combined with probe for quantitative detection of hsa-miR-30d by real-time PCR

[0045] In order to investigate the specificity and effectiveness of stem-loop primers in real-time PCR detection, the PCR templates were the precursor hsa-mir-30d

[0046] (5`GUUGU UGUAAACAUCCCCGACUGGAAG CUGUAAGACACAGCUAAGCUUUCAGUCAGAUGUUUGCUGCUAC 3`underlined base is the sequence of the mature body) and mature hsa-miR-30d (5`UGUAAACAUCCCCGACUGGAAG3`) standard RNA samples, and a series of diluted hsa-miR-30d standard cDNA samples. The total volume of the RT reaction system is 15 μl, including 1.5 μl 10× buffer, 50 U / μl reverse transcriptase 1.0 μl, 100 mM dNTP 0.15 μl, 20 U / μl RNA inhibitor 0.19 μl, 1 μM RT primer 3 μl, 0.01 μM template RNA 5 μl, DEPC water 4.16 μl. The reverse transcription PCR reaction was carried out on a BIO-RAD MyCycler qualitative PCR instrument. The reaction conditions are: 16°C for 30min, 42°C for 30min, 85°C for 5min, 4°C∞. The t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for amplifying a short-chain RNA (ribonucleic acid) and a related method thereof. The primer is oligonucleotide; a fragment of nucleotide sequence at the 5' end of the primer is fixed, and forms a structure with a nucleotide loop and a nucleotide stem; the 3' end of the primer is connected with 6 to 8 nucleotides, and is paired with the 3' end of a mature miR to form specific complementary binding; the 3' end of the nucleotide loop contains a fragment of nucleotide sequence with GC content of over 70 percent, and the fragment of nucleotide sequence is called a universal probe region; nucleotides on the 8th to 30th sites at the 5' end of the primer form a universal reverse primer region. The primer has an internal double-chain structure, and cannot be bound to a specific sequence in a nucleotide chain under the action of steric hindrance, and the reverse transcription of the sequence is avoided; the primer is only specifically paired with and bound to the 3' end for specific reverse transcription. The primer is high in specificity, easy to design, convenient to synthesize and suitable for the reverse transcription of the short-chain RNA, especially the mature miR, and the formation of a primer dimer is avoided.

Description

technical field [0001] The invention relates to the field of molecular detection, in particular to the technical field of design and application of reverse transcription primers used to detect mature miRs with a full length of 18-25nt in reverse transcription polymerase chain reaction (RT-PCR). Background technique [0002] Mature miR is a recently discovered type of single-stranded small molecule non-coding RNA with a full length of 18-25 nt, which is processed by the transcriptional precursor of the stem-loop structure (including about 1000 bp of pri-miRNA and about 60-70 bp of pre-miRNA) become. In November 2011, the Sanger miRBase database (version 18.0) was released, and more than 20,000 transcripts were found, including nearly 2,000 in humans. miRNAs, first discovered by Victor Ambros and his colleagues in nematodes, are a class of non-coding endogenous single-stranded small molecule RNAs. The 2-8nt seed region (seed region) at the 5' end of the target mRNA can be co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor刘晓光
OwnerZHOUSHAN HOSPITAL