Hepatitis B virus surface antigen recombinant chimeric protein, preparation method and application thereof

A technology of hepatitis B virus and chimeric protein, which is applied in the field of biomedicine, can solve the problems of low expression of cell lines, high cost, low yield, etc., to increase reactogenicity and immunogenicity, solve the problem of immune evasion, Strong immunogenic effect

Active Publication Date: 2014-06-18
GUANGZHOU WONDFO BIOTECH
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many scientific researchers have devoted themselves to the research of HBsAg in recent years, the Institute of Virology of China Preventive Veterinary College has also successfully developed HBsAg containing S and PreS1 genes expressed in CHO cells, but the expression level of the cell line is low, resulting in low yield , the cost remains high, which is far from meeting the needs of the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hepatitis B virus surface antigen recombinant chimeric protein, preparation method and application thereof
  • Hepatitis B virus surface antigen recombinant chimeric protein, preparation method and application thereof
  • Hepatitis B virus surface antigen recombinant chimeric protein, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The design of embodiment 1 recombinant chimeric protein HBsAg

[0030] Firstly, according to the sequence and epitope information of HBsAg reported at home and abroad, the coding genes of HBsAg S and PreS1 were selected and synthesized.

[0031] S

[0032]ATGGAGAACATCGCCAGTGGCCTGTTAGGTCCTTTACTGGTGCTGCAGGCC

[0033] GGCTTTTTCCTGCTGACCAAGATCCTGACCATCCCGCAGAGCCTGGACAGC

[0034] TGGTGGACCAGCCTGAACTTCTTAGGCGGCACCCCTGTTTGTCTGGGCCA

[0035] GAACAGCCAGAGCCAGATCAGCAGCCACAGTCCGACCTGTTGCCCTCCGA

[0036] TTTGTCCTGGCTATCGCTGGATGTGCCTGCGCCGCTTCATCATCTTCCTGTG

[0037] CATCCTGCTGCTGTGCCTGATTTTCCTGCTGGTTCTGCTGGACTACCAGGGT

[0038] ATGCTGCCTGTGTGCCCTCTGATCCCGGGCAGTAGCACCACCAGTACCGGT

[0039] CCGTGCAAGACCTGCACCACACCTGCCCAGGGCACCAGCATGTTCCCGAG

[0040] CTGCTGCTGCACCAAGCCGACAGACGGCAACTGCACCTGCATTCCGATCC

[0041] CGAGTAGCTGGGCCTTCGCCAAGTACCTGTGGGAATGGGCCAGCGTGCGC

[0042] TTCAGCTGGCTGAGTCTGCTGGCCCCGTTCGTGCAGTGGTTCGTGGGCTTA

[0043] AGCCCGACCGTGTGGCTGAGCGTGATCTGGATGATGTGGTTCTGGGGCCC...

Embodiment 2

[0071] Preparation of embodiment 2 recombinant chimeric protein

[0072] 1. Preparation of HBsAg

[0073] First, in order to facilitate the prokaryotic expression of the fusion peptide, the above amino acid sequence was optimized according to the amino acid sequence of the above protein, and Suzhou Jinweizhi Biotechnology Co., Ltd. was entrusted to synthesize it.

[0074] (1) Using the synthesized S (SEQ ID NO.1) as a template, the upstream primer SP15'-CTAGGATCCATCCTGACCATCCCGCAG-3' (SEQ ID NO.3), the downstream primer SP25'-CCCAAGCTTGAACCACTGCACGAACGG-3' (SEQ ID NO.4) PCR amplification was carried out under the following conditions: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 40 s, annealing at 56°C for 40 s, extension at 72°C for 50 s, 34 cycles, and final extension at 72°C for 10 min. The PCR product (base composition such as SEQ ID NO.2) was detected by agarose gel electrophoresis (see figure 1 ) was double-digested with BamHI and HindIIII, and then com...

Embodiment 4

[0088] The specificity experiment of embodiment 4SS1 colloidal gold immunochromatography test strip

[0089] In order to explore the specificity of the recombinant chimeric protein on the surface of hepatitis B virus developed by the present invention, we will standardize the recombinant chimeric protein solution of the amino acid composition of the present invention such as SEQ ID NO. Test strips (temporarily called "SS1 colloidal gold test strips") were made by conventional methods, and 1,050 clinical samples were tested simultaneously with purchased ELISA kits and hepatitis B colloidal gold test cards. The results showed that SS1 colloidal gold test strips, external Purchased ELISA kits, hepatitis B colloidal gold detection card A, and hepatitis B colloidal gold detection card B detected positive results in 77 cases, 77 cases, 73 cases, and 74 cases, respectively. The re-examination of the test cards by many companies proves that the accuracy rate of the 1050 samples tested...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses a hepatitis B virus surface antigen recombinant chimeric protein, a preparation method and an application thereof, wherein the amino acid composition of the hepatitis B virus surface antigen recombinant chimeric protein is represented by SEQ ID NO. 9 or shares 90% sequence identity with the amino acid sequence represented by SEQ ID NO:9. The preparation method comprises: constructing recombinant plasmid pET-28a-S, constructing recombinant plasmid pET-28a-S-S1, and expressing and purifying the hepatitis B virus surface antigen recombinant chimeric protein. The hepatitis B virus surface antigen recombinant chimeric protein has high sensitivity and high specificity, and can be applied in the biomedical field, especially in the hepatitis B virus surface antibody colloidal gold detection test paper strip.

Description

technical field [0001] The invention belongs to the field of biomedicine, and relates to a hepatitis B virus surface antigen recombinant chimeric protein, a preparation method thereof, and an application in the field of immune chromatography analysis. technical background [0002] Hepatitis B virus (HBV) is a DNA virus, and its infection is a worldwide public health problem. There are about 130 million chronic hepatitis B virus carriers in China, and the carrier rate of hepatitis B surface antigen is about 10%. 300,000 people eventually died of chronic diseases related to hepatitis B, which is the number one killer among chronic infectious diseases. Patients with chronic HBV infection mainly present with liver damage and metabolic disorders related to steatosis and fibrosis, and patients with long-term infection may also develop liver cirrhosis and hepatocellular carcinoma. The treatment of hepatitis B can be divided into two categories: one is antiviral treatment. Antivir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/02C12N15/70G01N33/68G01N33/558A61K39/29A61P31/20
CPCA61K39/00C07K14/005C12N15/70C12N2730/10122C12N2730/10134G01N33/56983G01N2333/02
Inventor 才蕾任艳娜唐时幸王继华
Owner GUANGZHOU WONDFO BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products