Zea mays L. endosperm specific expression promoter 14kD zein promoter, and cloning method thereof
A corn endosperm and promoter technology, applied in the direction of DNA / RNA fragments, DNA preparation, recombinant DNA technology, etc., can solve the problems of biological safety and hidden dangers, and achieve a highly specific effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1: Obtaining Promoter Fragments
[0044] Find the ATG upstream sequence of the maize endosperm-specific expression gene 14kD zein in the NCBI database, intercept the 2031bp base sequence, see SEQ ID NO. , see figure 1 . Primer sequences for amplified fragments:
[0045] The forward primer is from 5' end to 3' end: CCCTCAGAACCATACCTT;
[0046] The reverse primer from the 5' end to the 3' end is: GGTGTCGAGTTCTCCAATC;
[0047] Results: After the 2031bp target fragment was obtained, TA was cloned to connect the vector, sequenced and compared, and it was consistent with the sequence provided in the database.
Embodiment 2
[0048] Embodiment 2: the acquisition of promoter truncated fragment
[0049]According to the prediction results of the website for predicting promoter elements (http: / / www.softberry.com), the base sequences of 1043bp, 588bp, 443bp, 302bp, 202bp, and 104bp were intercepted respectively, and the fragments were obtained by PCR, see figure 2 . Primer sequences for amplified fragments:
[0050] 1043bp:
[0051] Forward primer from 5' end to 3' end is: TCGAGAAATGACGTGGCA;
[0052] The reverse primer is from 5' end to 3' end: GGTGTCGAGTTTCTCCAATC;
[0053] 588bp:
[0054] Forward primer from 5' end to 3' end is: ATTCACGGGTAATCTCAG;
[0055] The reverse primer is from 5' end to 3' end: GGTGTCGAGTTTCTCCAATC;
[0056] 443bp:
[0057] Forward primer from 5' end to 3' end is: TTAATTGGGTGAGAAACA;
[0058] The reverse primer is from 5' end to 3' end: GGTGTCGAGTTTCTCCAATC;
[0059] 302bp:
[0060] Forward primer from 5' end to 3' end is: TAGTTTCGTGAAAAGCAA;
[0061] The reverse p...
Embodiment 3
[0069] Example 3: The truncated fragment is connected to the GUS gene, and the gene gun is used to verify the core elements of the promoter
[0070] use Sma Ⅰ+ EcoR Ⅰ Spot the gusA-NOS fragment from the pBI121 vector (see image 3 ) was digested and ligated to the pUC18 vector (see map Figure 4 ), construct the pUC18-Gus-nos vector. After the cloned fragments of different lengths were retrieved and ligated and sequenced to verify that they were correct, use Xba I+ Sma I digested, connected into pUC18-Gus-nos, and constructed pUC18-14kD zein-GUS vector. The constructed vector was transformed into Escherichia coli TOP10, and the plasmid was extracted and injected with a gene gun.
[0071] The grains of B73 maize 14 days after pollination were selected as the recipient material, sterilized with 70% alcohol and peeled off the seed coat, placed on the osmotic medium and cultured for 6 hours before the transient transformation of the gene gun. The bombardment paramet...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 