Unlock instant, AI-driven research and patent intelligence for your innovation.

Zea mays L. endosperm specific expression promoter 14kD zein promoter, and cloning method thereof

A corn endosperm and promoter technology, applied in the direction of DNA / RNA fragments, DNA preparation, recombinant DNA technology, etc., can solve the problems of biological safety and hidden dangers, and achieve a highly specific effect

Inactive Publication Date: 2014-07-30
SHANGHAI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the current plant genetic engineering, some regulatory elements from viruses, bacteria, etc. are often used, and there are also hidden dangers of causing biological safety problems.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zea mays L. endosperm specific expression promoter 14kD zein promoter, and cloning method thereof
  • Zea mays L. endosperm specific expression promoter 14kD zein promoter, and cloning method thereof
  • Zea mays L. endosperm specific expression promoter 14kD zein promoter, and cloning method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Obtaining Promoter Fragments

[0044] Find the ATG upstream sequence of the maize endosperm-specific expression gene 14kD zein in the NCBI database, intercept the 2031bp base sequence, see SEQ ID NO. , see figure 1 . Primer sequences for amplified fragments:

[0045] The forward primer is from 5' end to 3' end: CCCTCAGAACCATACCTT;

[0046] The reverse primer from the 5' end to the 3' end is: GGTGTCGAGTTCTCCAATC;

[0047] Results: After the 2031bp target fragment was obtained, TA was cloned to connect the vector, sequenced and compared, and it was consistent with the sequence provided in the database.

Embodiment 2

[0048] Embodiment 2: the acquisition of promoter truncated fragment

[0049]According to the prediction results of the website for predicting promoter elements (http: / / www.softberry.com), the base sequences of 1043bp, 588bp, 443bp, 302bp, 202bp, and 104bp were intercepted respectively, and the fragments were obtained by PCR, see figure 2 . Primer sequences for amplified fragments:

[0050] 1043bp:

[0051] Forward primer from 5' end to 3' end is: TCGAGAAATGACGTGGCA;

[0052] The reverse primer is from 5' end to 3' end: GGTGTCGAGTTTCTCCAATC;

[0053] 588bp:

[0054] Forward primer from 5' end to 3' end is: ATTCACGGGTAATCTCAG;

[0055] The reverse primer is from 5' end to 3' end: GGTGTCGAGTTTCTCCAATC;

[0056] 443bp:

[0057] Forward primer from 5' end to 3' end is: TTAATTGGGTGAGAAACA;

[0058] The reverse primer is from 5' end to 3' end: GGTGTCGAGTTTCTCCAATC;

[0059] 302bp:

[0060] Forward primer from 5' end to 3' end is: TAGTTTCGTGAAAAGCAA;

[0061] The reverse p...

Embodiment 3

[0069] Example 3: The truncated fragment is connected to the GUS gene, and the gene gun is used to verify the core elements of the promoter

[0070] use Sma Ⅰ+ EcoR Ⅰ Spot the gusA-NOS fragment from the pBI121 vector (see image 3 ) was digested and ligated to the pUC18 vector (see map Figure 4 ), construct the pUC18-Gus-nos vector. After the cloned fragments of different lengths were retrieved and ligated and sequenced to verify that they were correct, use Xba I+ Sma I digested, connected into pUC18-Gus-nos, and constructed pUC18-14kD zein-GUS vector. The constructed vector was transformed into Escherichia coli TOP10, and the plasmid was extracted and injected with a gene gun.

[0071] The grains of B73 maize 14 days after pollination were selected as the recipient material, sterilized with 70% alcohol and peeled off the seed coat, placed on the osmotic medium and cultured for 6 hours before the transient transformation of the gene gun. The bombardment paramet...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to zea mays L. endosperm specific expression promoter 14kD zein promoter, and a cloning method thereof. Subsequence of the zea mays L. endosperm specific expression promoter 14kD zein promoter is one selected from following sequences: i) a nucleotide sequence represented by SEQ ID No.1; and ii) a nucleotide sequence which is obtained via substitution, deletion and / or addition of one or a plurality of nucleotides of the nucleotide sequence represented by SEQ ID No.1, and possesses the same functions. According to function analysis of the 14kD zein promoter, it is confirmed that the 14kD zein promoter is suitable for starting specific expression of target genes in zea mays L. endosperm on experimental level, and low expression or no expression is promoted in other tissues. An appropriate controlling element is provided for plant genetic engineering expression vector construction, and novel materials are provided for researches of other experimental subjects.

Description

technical field [0001] The invention relates to a maize endosperm specific expression promoter 14kD zein promoter and a cloning method thereof. technical background [0002] Corn (Zea mays L.), also known as maize, is an important food crop, an excellent feed and industrial raw material. Therefore, a lot of research is devoted to transferring foreign genes into maize to breed new varieties that meet people's needs. Today's transgenic technology usually employs strong constitutive promoters to drive the efficient expression of foreign genes. The disadvantage is that the constitutive promoter enables all-round expression of the foreign gene in the plant, resulting in unnecessary waste of energy. Second, constitutive promoters often cause gene pleiotropy, as well as cause food safety problems. [0003] Localized expression of exogenous genes in transgenic plants can not only reduce plant burden and reduce the impact on crop agronomic traits, but also increase the expression ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N5/10C12N15/10
Inventor 宋任涛邢莹莹王明民张举善马东东王珊珊祁巍巍梅冰唐远平
Owner SHANGHAI UNIV