Check patentability & draft patents in minutes with Patsnap Eureka AI!

Breeding method capable of changing glume color of rice varieties with yellow glume to brownness

A technology of rice and chaff, applied in the field of rice biotechnology breeding, which can solve the problems of high cost, long breeding cycle, and insufficient focusing ability

Active Publication Date: 2014-08-13
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF0 Cites 38 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At this time, the focus ability of traditional breeding based on hybridization-backcrossing is slightly insufficient, and the breeding cycle is long and the cost is also high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Breeding method capable of changing glume color of rice varieties with yellow glume to brownness
  • Breeding method capable of changing glume color of rice varieties with yellow glume to brownness
  • Breeding method capable of changing glume color of rice varieties with yellow glume to brownness

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] The test methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

[0034] Target Fragment Selection

[0035] Select the target fragment in the exon region of the rice glume color-determining gene OsCAD2 (LOC_Os02g09490.1), and one strand of the selected double-stranded target fragment must have a 5'-(N) X -NGG-3' structure, (N) X Represents a base sequence {N with number X 1 ,N 2 ...N x}, N 1 ,N 2 ...N x Each of them represents any one of A, G, C, T. N in NGG is any one of A, G, C, T. On the exon of the OsCAD2 gene, with the (N) X -There are 96 fragments of NGG-3' structure that can be selected as targets.

[0036] In this example, the nucleotide sequence CCGCCGAGAAGACCGTCACC at positions 14-36 after the translation initiation codon ATG on the first exon of the rice OsCAD2 gene (LOC_Os02g09490.1) w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a breeding method capable of changing the glume color of rice varieties with yellow glume to brownness. The breeding method comprises the following steps: selecting a target fragment in an extron region of a glume color determining gene OsCAD2, constructing a plant CRISPR / Cas9 targeting recombinant vector, guiding the recombination vector into a rice cell, regenerating the rice cell into seedlings, and sequencing genome target fragments of regenerated strains so as to obtain the strains, two allelic genes OsCAD2 of which simultaneously suffer function deletion mutation. Through phenotype identification, the change of the glume color is realized. Experiments prove that the breeding method can quickly change the glume color of the rice varieties.

Description

technical field [0001] The invention relates to the field of rice biotechnology breeding, in particular to a breeding method for improving the chaff color of existing rice varieties with yellow chaff to brown. Background technique [0002] After more than 30 years of research and development in my country's hybrid rice seed production technology, not only the seed production technology is mature, but also the seed production yield has doubled, which has played a key role in the continuous increase in the yield of my country's main crops. However, hybrid rice seed production technology still has problems such as low seed production efficiency, high labor intensity, difficult control of seed quality, and unstable seed yield. The effective way to solve these problems is to realize the whole process of mechanized mixed sowing seed production. Due to the mixed harvest of parents and hybrid parents in mixed seed production, appropriate markers are needed to distinguish hybrid see...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H4/00A01H5/00
Inventor 魏鹏程杨剑波李莉宋丰顺马卉倪金龙秦瑞英李浩陆徐忠杨亚春
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More