Construction method of vlp vaccine presenting il-33 for active immunotherapy of chronic asthma
A technology for active immunization and chronic asthma, applied in the field of medical biology, can solve problems such as ineffective treatment of asthma, achieve the effects of mucus secretion inhibition, simple preparation, and strong immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0058] 1) Routine total RNA was extracted from mouse lung tissue with RNAisoPlus; and the obtained total RNA was reverse-transcribed into total cDNA by conventional reverse transcription with a reverse transcription kit; the obtained total cDNA was amplified by PCR with designed specific primers The gene encoding the mature fragment of IL-33 was obtained, and the specific primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., as follows:
[0059] Upstream primer (5' end) of the gene encoding the mature fragment of IL-33: gtggatccagcatccaaggaacttcac
[0060] Downstream primer (3' end) of the gene encoding the mature fragment of IL-33: gtgaattcgattttcgagagcttaaac
[0061] And in the following PCR system (20 microliters): 5' end primer: 0.2 microliters, 3' end primer: 0.2 microliters, 10XPCR buffer: 2 microliters, dNTP: 1.6 microliters, Taq enzyme: 0.2 microliters, cDNA Template: 1 microliter, double distilled water: 14.8 microliters, perform the following PCR a...
PUM
| Property | Measurement | Unit |
|---|---|---|
| antibody titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 