Method for detecting ToMV resistant gene Tm2<2> by using allele specific PCR technology
A resistance gene and specific technology, applied in the field of plant protection, can solve the problems of high detection cost and long detection time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0091] A test kit comprising:
[0092] Template DNA 20~60ng,
[0093] Taq DNA polymerase 0.5 U,
[0094] dNTPs each 10mmol / L 0.5μL,
[0095] 2.5 μL of 10×PCR buffer,
[0096] Primer pair 1:
[0097] 5 , End primer 10μmol / L 2.5μL, Tmfk-g: 5′CCATGAGTAGTTCAACCCAgTA 3′
[0098] 3 , End primer 10μmol / L 2.5μL. TmR801: 5′ ctctcaagaacaccatatag 3′
[0099] Primer pair 2:
[0100] 5 , End primer 10μmol / L 2.5μL, Tmfg-c: 5′CCATGAGTAGTTCAACCCAcGC 3′
[0101] 3 , End primer 10μmol / L 2.5μL. TmR2: 5′TTGATGTTGAAGGTGATATGATGA 3′
Embodiment 2
[0103] Practical application:
[0104] 1. Materials:
[0105] In the spring of 2009, CLN5915 (3164) was used as the male parent (commercially available), and L-402 (commercially available).
[0106] 2. Method
[0107] 2.1 Seedling cultivation
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap