Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting ToMV resistant gene Tm2<2> by using allele specific PCR technology

A resistance gene and specific technology, applied in the field of plant protection, can solve the problems of high detection cost and long detection time.

Active Publication Date: 2014-11-26
TIANJIN CITY AGRI BIO TECH RES CENT
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Aiming at the shortcomings of this method, such as high detection cost and too long detection time, the inventors have carried out a lot of research work, determined the genetic differences in resistant and susceptible varieties through gene cloning and sequencing, and established Tm2 by using allele-specific PCR. 2 genetic testing system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting ToMV resistant gene Tm2&lt;2&gt; by using allele specific PCR technology
  • Method for detecting ToMV resistant gene Tm2&lt;2&gt; by using allele specific PCR technology
  • Method for detecting ToMV resistant gene Tm2&lt;2&gt; by using allele specific PCR technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] A test kit comprising:

[0092] Template DNA 20~60ng,

[0093] Taq DNA polymerase 0.5 U,

[0094] dNTPs each 10mmol / L 0.5μL,

[0095] 2.5 μL of 10×PCR buffer,

[0096] Primer pair 1:

[0097] 5 , End primer 10μmol / L 2.5μL, Tmfk-g: 5′CCATGAGTAGTTCAACCCAgTA 3′

[0098] 3 , End primer 10μmol / L 2.5μL. TmR801: 5′ ctctcaagaacaccatatag 3′

[0099] Primer pair 2:

[0100] 5 , End primer 10μmol / L 2.5μL, Tmfg-c: 5′CCATGAGTAGTTCAACCCAcGC 3′

[0101] 3 , End primer 10μmol / L 2.5μL. TmR2: 5′TTGATGTTGAAGGTGATATGATGA 3′

Embodiment 2

[0103] Practical application:

[0104] 1. Materials:

[0105] In the spring of 2009, CLN5915 (3164) was used as the male parent (commercially available), and L-402 (commercially available).

[0106] 2. Method

[0107] 2.1 Seedling cultivation

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a specific primer for detecting a tomato mosaic virus (ToMV) resistant gene Tm2<2>. The specific primer has a DNA sequence shown as SEQIDNO:1-SEQIDNO:4. The invention also provides a kit for detecting the ToMV resistant gene Tm2<2> by using the specific primer. By using the kit to detect the ToMV resistant gene Tm2<2>, operations are simple and accuracy is high.

Description

technical field [0001] The invention belongs to plant protection technology, and relates to a detection method of tomato mosaic disease resistance gene, more specifically a fast, simple and economical anti-tomato mosaic virus gene Tm2 2 detection method. Background technique [0002] Tomato mosaic disease is a worldwide tomato disease with a wide distribution and serious damage. The main symptoms are mosaic leaves, fern leaves, dwarfing, yellowing, necrosis and other symptoms. Once the disease occurs, it will spread rapidly and cause immeasurable losses to production. With the in-depth research on the relationship between tomato and TMV. It was found that there are three main TMV-resistant genes available to tomato breeders in the genus Tomato: Tm-1, Tm-2, and Tm2 2 (Tm-2a), which is derived from tomato germplasm resources I. P. 128650 ( L.chilense) Tm-2 2 The genes showed high resistance to different strains. For this gene Dax et al. have developed a SCAR marker. T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q2525/117C12Q2531/113
Inventor 金凤媚薛俊宋建刘仲齐
Owner TIANJIN CITY AGRI BIO TECH RES CENT
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More