MYL3 gene for regulating small-tail Han sheep skeletal muscle growth and application of MYL3 gene
A technology of small-tailed Han sheep and skeletal muscle, applied in the field of molecular biology, can solve the problems of unclear and unseen regulation mechanism of muscle growth and development.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1: Extraction and reverse transcription of total RNA from longissimus dorsi tissue of Small Tail Han sheep
[0039] Get about 20 g of the longissimus dorsi muscle of Small Tail Han sheep, and use the total RNA extraction kit (No.CW0580) of Kangwei Century Company to extract the total RNA of the muscle tissue; .05081955001) to synthesize the first strand of cDNA by reverse transcription, and store at -20°C for future use.
Embodiment 2
[0040] Example 2: Cloning and sequencing of cDNA conserved region sequences
[0041] (1) Design of primers: Download the cDNA sequences of MYL3 genes of various species such as human, pig, cow, and mouse from NCBI, and compare them with DNAMAN6.0 software to obtain the conserved region sequences. The primers for the conserved regions of the gene cDNA are designed as follows: F1: GGAGGCTCACCCTACCCTG, as shown in SEQ ID NO.3, and F2: GCCATGATGTGCTTGACAAATGC, as shown in SEQ ID NO.4;
[0042] (2) PCR amplification: use the first strand of cDNA obtained in Example 1 as a template, and use TIANGEN’s PCR MasterMix kit (KT201) for PCR amplification; the 50 μl amplification system includes: PCR MasterMix 25 μl; F1 (10×) 2 μl; F2 (10×) 2 μl; cDNA first strand 2 μl. The amplification conditions are: 94°C, 5min; (94°C for 30s, 58°C for 30s, 72°C for 1min) 35cycles; 72°C, 10min. The results of the amplification are attached figure 1 ;
[0043] (3) Recovery of amplified bands: PCR ampl...
Embodiment 3
[0048] Example 3: Cloning and sequencing of cDNA 3' end sequence
[0049] The 3' end of the cDNA sequence was cloned by landing nested PCR method, and the specific steps were as follows:
[0050] (1) Design and synthesis of primers: According to the sequencing results of the cDNA conserved region of the MYL3 gene obtained in Example 2, two upstream nested primers were designed, 3'GSP: GGACACCGGCACCTATGAGGAC, as shown in SEQ ID NO.5, and 3' NGSP: GAGAAGCTGATGGCGGGGCAAG, as shown in SEQ ID NO.6; and synthesize two downstream 3' universal primers, 3'-UP: GACTCGAGTCGATCGA, as shown in SEQ ID NO.7, and OligodT-AP: GACTCGAGTCGATCGA(T)18, As shown in SEQ ID NO.8.
[0051] (2) Synthesize the first strand of cDNA by reverse transcription: take 100 pg~1 μg of the RNA extracted in Example 1, add OligodT-AP as the reverse transcription primer and synthesize the first strand of cDNA by reverse transcription;
[0052] (3) Outer PCR amplification: with 3′ GSP and OligodT-AP as upstream and d...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More